... management of extensive loss of femoral and/ or acetabular bone Mechanical complications and reconstruction strategies The exact rate of mechanical complications following hip spacer implantation remains ... on the operated extremity, the patient should be rather considered as a candidate for a resection arthroplasty and not for a spacer implantation For prevention of any spacer dislocation due to ... This implantation technique also offers the advantage of a prevention of a spacer migration into the pelvis (Figure 4) beside a normal articulation and prevention of any spacer dislocation Hereby,...
... SM and Neural Network, SM and Euclidean Distance, Image Averaging and Neural Network, and Image Averaging and Euclidean Distance Table 1: Errors rates for data from MNIST Table 2: Errors rates ... experimental results of DUT and MNIST databases (a) DUT database Figure introduces the GUI The user types the name of the JPEG file and the corresponding number of students, and then clicks Convert ... is applied to smoothen the number and eliminate small noise regions Finally, normalization is used to regulate the size, position and shape of the image so that the differences between samples...
... description of the standardization methodology and country tables of standardized BOP expenditure data by sector and income level.) Combining income and expenditure data allows estimation of the size of ... portrait of the BOP—based on recorded incomes and expenditures and an overview of sector -specific business strategies from successful enterprises operating in BOP markets These data and the record of ... countries of Africa and Asia, and urban BOP markets larger in most countries of Eastern Europe and Latin America • • What does the BOP buy? The survey data record interesting patterns in what BOP...
... r e s t r y , and Fishing Research at NIOSH and intervention through (1) identification and characterization of injuries and illness and detailed characterization of populations at risk through ... (2) identification and characterization of special populations and the unique health and safety risks they face; (3) identification and characterization of health effects associated with chemical, ... information in an accessible, understandable, and helpful format Research has informed public policy and regulatory initiatives at the federal level and in several states It is vital that independent,...
... Pryor and Jentoft, 1961 Anderson and Prausnitz, 1986 Miller and Hawthorne, 2000 Mathis et al., 2004 Alwani and Schneider, 1969 Pryor and Jentoft, 1961 Pryor and Jentoft, 1961 Pryor and Jentoft, ... the numerator indicates the number of units of solute and the denominator shows the number of units (usually one unit) of solution (or of solvent, if it is indicated) A designation of the units ... method of weight-loss of crystalls is used for measurements of solid solubility; Vis.obs – the method of visual observations is used for determination of phase equilibria at elevated temperatures and...
... Lack of controls over monies on deposit No reports to inspectors No evidence of notification to depositors of unclaimed funds No assurance that conditions that may be created by owners who abandon ... percentage of requests responded to within 72 hours and resolved within 60 days This limited focus did not identify that high priority or hazardous conditions were part of the on-going backlog and some ... response time, the quality of inspections may have suffered Half of the inspection staff said they compromise the quality of their work, at least sometimes, because of time constraints One in...
... Fund (contd) System implemented in 1997 Monies used for general maintenance and implementation of other systems (HR, AR, and employee tracking) This is trial version www.adultpdf.com Special Services ... System Development Fund 1991 ordinance - 6% surcharge to finance an automated Plan Check and Inspection Status (PCIS) System Monies deposited into the fund - $5 million annually Balance ... delinquency This is trial version www.adultpdf.com User Fees Building permit fee and plan check fee based on valuation of the construction Revenue highly dependent on market conditions This is trial...
... Our data suggest that upregulation of proinflammatory mediators and molecules facilitate leucocyte adhesion to the endothelium and migration into tissue, thereby representing an essential and ... pathogenesis of RA would permit the development of strategies to impede the manifestation of the disease In numerous organ pathologies, the activation of circulating leucocytes, and their interaction ... integral part not only of the perpetuation and propagation of disease but also of its initiation Apart from adhesion molecules, a few chemokines and inflammatory mediators were found among the genes...
... effectiveness of group work in speaking lessons at EFLHUI? Basing on the investigated data and the real behaviors of the participant and also the quality of teaching and learning speaking at the FFL-HUI, ... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST – GRADUATE STUDIES HỒ THỊ HIỀN AN INVESTIGATION INTO THE PERCEPTIONS AND ACTUAL BEHAVIORS OF THE ... results of this study helped to facilitate the application of group work in teaching and learning speaking to improve the effectiveness of speaking lessons at the FFL-HUI Research questions a What...
... with the body of knowledge taught and that teachers‟ effectiveness is subject specific The implication of this for teachers is that they must thoroughly understand the content of what they teach ... effectiveness of group work in speaking lessons at EFLHUI? Basing on the investigated data and the real behaviors of the participant and also the quality of teaching and learning speaking at the FFL-HUI, ... provinces in the north of the nation This various background creates a variety in the classrooms in terms of cultural features, accents, ways of thinking, habits, and their pronunciation Thanks to these...
... specificheat Cv taking account of only lattice vibrations from SMM, Cvrot + Cvvib is the specificheat Cv taking account of both lattice vibration and molecular rotations from SCFM and SMM and ... account of molecular rotation Our calculated vibrational and rotational specific heats for molecular cryocrystals of N2 type such as N2 , CO, N2 O and CO2 cryocrystals are summarized and discussed ... and discussed in Sec.III II THEORY OFSPECIFICHEATAT CONSTANT VOLUME FOR MOLECULAR CRYOCRYSTAL OF NITROGEN TYPE II.1 Theory of vibrational specificheatat constant volume for crystal with...
... case of BaTiO3 films, the asymmetry of barium sites plays the prime role STUDY ON LATTICE AND ELECTRONIC STRUCTURES AT THE SURFACE OF 215 Table The location and DOS peak structure of energy bands ... the band gap reducing, the downward broadening of both valence and conducting bands and two additional peaks at -2.7 and -0.4 eV (no.2d and 2f) which have the origin of STUDY ON LATTICE AND ELECTRONIC ... BSs used for investigation: (a) BaO-terminated slab and (b) TiO2 -terminated slab; (c) and (d) are perspective views at 30o along x direction of BaO-terminated and TiO2-terminated films in polyhedral...
... user-created data base, and generating a list of tentatively identified compounds with their retention times and scan numbers The software must also allow integration of the ion abundance of any specific ... dechlorinated and acidified immediately prior to fortification with internal standards and surrogates, and extraction using the same quantities of acid and sodium sulfite described above 8.2.2 Atraton ... concentration of analyte or surrogate in µg/L in the water sample Ax = integrated abundance of the quantitation ion of the analyte in the sample Ais = integrated abundance of the quantitation ion of...
... chemical and physical properties to Program Offices (e.g., Office of Water, Office of Solid Waste and Emergency Response, Office of Prevention, Pesticides and Toxic Substances) and Regional Offices ... Refractive Index Vapor Pressure Viscosity Boiling Point HeatofVaporizationHeatof formation Diffusion Coefficient in Air Diffusion Coefficient in Water Activity Coefficient Solubility Gas/Liquid Partition ... δrespKa, δelepKa and δsolpKa describe the differential resonance, electrostatic and solvation effects of P on the protonated and unprotonated states of C, respectively Electrostatic interactions...
... Hydrogenation of unsaturated hydrocarbons always gives off heat, hence the molar enthalpy change of hydrogenation Ahyd//298 is always negative Heats ofHydrogenation The molar enthalpy of formation ... part of hydrogen thermochemistry: Vll Vlll Heats of Hydrogenation Practical and historical aspects of experimental determination of the enthalpies of hydrogenation and formation \ydH29S and Af ... one speaks of its "heat" of combustion ACU and if a hydrogenation is run at constant pressure P, one speaks of its heatof hydrogenation, meaning its Ah d // Energy and enthalpy are related by...
... ALIPHATIC COMPOUNDS importance of these data and the fact that the result dependent upon the density and potential of the electric current and the influence ofof the electrolysis is the dissociative ... form of Kolbe's ' classical investigations organic compounds, in salts on the electrolysis of which he demonstrated the formation of the hydrocarbons from the acids, are the foundation of later ... yielded a mixture of several unsaturated hydrocarbons, a result similar to that obtained in the investigation of potas- sium oleate, ofvarious the only outcome of which was a mixture compounds which...
... regulatory factors that control expression of target genes [23] Their high biological specificity comes from cooperation with specific cofactors that contribute to modulate DNA binding specificity ... AAGACCTCTAAGAGCCTGCC TTCACCTCTCCCATAAAGCC CCCAATGTAGGAACAGCCAG GGTTGCTTTGCATGTCATTC TCTTGATTTTGGTTCGGTCG TCTGCCTCCCTTTTCCTACA GATGGCATGACCGATACAGA AAACAGCCACCCAATCTCAG TGTTTGCTGATTGCTTCGAC PBX1 exon PBX1 ... cycles of 45 s at 96°C, 45 s at an initial melting temperature (Tm) of 69°C (with a 1°C Tm decrease by each cycle), and 60 s at 72°C Amplification was then achieved by 11 cycles of 45 s at 96°C,...
... 2008 31 CURRENT STATUS OF EXPLOSIVE DESTRUCTION TECHNOLOGIES TABLE 3-1 Concentrations of Volatile OrganicCompoundsat the Inlet and Outlet of Air Filtration Unit #2 of the TDC of CH2M HILL (parts ... Emissions of Particulate Matter, Dioxin/Furan, HCl, and Semivolatile OrganicCompounds from the TDC of CH2M HILL Emission Type Amount Particulate matter Dioxin/furan HCl Semivolatile organiccompounds ... recycling Decontamination is accomplished by heating the materials to 1000°F for at least 15 minutes Electrical resistance heaters externally heat the muffle walls, which in turn radiate heat to the munitions...
... Figure Inhibition of HIV-1 binding and replication Inhibition of HIV-1 binding and replication GHOST cells were plate at × 105/well in 12-well plates and incubated at 37°C in CO2 atmosphere with ... HIV-1 GHOST X4/R5 and GFP expressing cells were plate at × 105/well in 12-well plates and incubated at 37°C in CO2 atmosphere with increasing concentrations of SP4-2, as indicated, then infected ... biologically active molecule, and that it would be a lead candidate for bioactivityguided isolation of active compounds mediating HIV-1 inhibition Here, we report the isolation of a bioactive fraction...