function use of a child apos s protolanguage
standard specification for producing a skid-resistant surface on concrete by the use of a multi-component epoxy s
Ngày tải lên :
24/10/2014, 22:12
... for Resistance to Degradation of Small-Size Coarse Aggregate by Abrasion and Impact in the Los Angeles Machine Standard Method for Sieve Analysis of Fine and Coarse Aggregates Standard Test Method ... specification is generally imperative and terse, and may include incomplete sentences Omissions of phrases and of words such as “the contractor shall,” “in accordance with,” “shall be,” “as indicated,” ... surfaces limited to pedestrian traffic only, the designer may desire to choose a less coarse aggregate gradation The preparation and inspection of a small sample using the proposed aggregate and...
- 6
- 242
- 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx
Ngày tải lên :
21/12/2013, 19:15
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe should ... this? _ Step Put the tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on ... _ Name one important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1...
- 2
- 392
- 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc
Ngày tải lên :
18/01/2014, 04:20
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe should ... this? _ Step Put the tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on ... _ Name one important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1...
- 2
- 374
- 0
Skills-based health education including life skills: An important component of a Child-Friendly/Health-Promoting School potx
Ngày tải lên :
14/03/2014, 20:20
... SITUATION ANALYSIS AND CASE STUDIES Situation analysis activities allow students to think about, analyse, and discuss situations they might encounter Case studies are real-life stories that describe ... representative organisations, counsellors, students, administrators, staff, parents, and school-based service workers 1.4 WHAT ARE SKILLS-BASED HEALTH EDUCATION AND LIFE SKILLS? Skills-based health ... in all schools: • Health-related school policies Health policies in schools can help ensure a safe and secure physical and psychosocial environment; address issues such as abuse of students, sexual...
- 90
- 435
- 0
Danger! A True History of a Great City''''s Wiles and Temptations pot
Ngày tải lên :
17/03/2014, 20:20
... earliest essays at the American bar have been fairly and impartially told by another pen, and, as the autobiographical form of narrative has its limitations as well as its advantages, the reader ... officials of all kinds, and all classes of females, mistresses, nymphs du pave, inmates of assignation houses, all intent on fun and dissipation, and a desire to not only see the elephant, but ... principal magnet used to draw customers to these saloons She was and is to-day, in fact, the only attraction Music of a coarse description is used to attract the passer-by, who, glancing at the place...
- 141
- 329
- 0
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
Ngày tải lên :
23/03/2014, 19:20
... Each pairwise comparison of judges also shows a strong pattern of symmetric disagreement The results of this analysis are presented in Table 3 Also as in step 3, the two-category latent class ... investigate in future work, such as features based on tags assigned to previous utterances (see, e.g., (Wiebe et al., 1997; Samuel et al., 1998)), and features based on semantic classes, such as ... Bruce and J Wiebe to appear Recognizing subjectivity: A case study of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic...
- 8
- 354
- 0
theory of functions of a real variable - s. sternberg
Ngày tải lên :
31/03/2014, 15:23
... This is known as the parallelogram law It is the algebraic expression of the theorem of Apollonius which asserts that the sum of the areas of the squares on the sides of a parallelogram equals ... } of points which are dense For example R is separable because the rationals are countable and dense Similarly, Rn is separable because the points all of whose coordinates are rational form a ... I have taught the beginning graduate course in real variables and functional analysis three times in the last five years, and this book is the result The course assumes that the student has seen...
- 393
- 305
- 0
báo cáo hóa học: " Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pptx
Ngày tải lên :
18/06/2014, 19:20
... user-manual, presenting norms of larger CA population samples Our study has a limitation in that data assessed at months are based on a relatively small sample size (n = 41–42) Larger sample sizes ... the data analysis Severity of disease was derived from the TISS (Therapeutic Intervention Scoring System) scores The TISS is a well- Table 2: General characteristics of patients and parents Patients ... factual intensity of nursing care in a hospital setting [27,28] In our department TISS is used as a standard assessment score (see Table 2) Design This is a prospective, longitudinal study comprising...
- 10
- 508
- 0
báo cáo hóa học: " A pilot study evaluating use of a computer-assisted neurorehabilitation platform for upper-extremity stroke assessment" pptx
Ngày tải lên :
19/06/2014, 08:20
... target speed in the trajectory tracking tasks across subjects Also, these results suggest that PTT emerges as a potentially sensitive assessment metric for trajectory tracking tasks across various ... width and height of the workspace Data and statistical analysis Representative tasks were analyzed across subjects using the performance metrics defined in Table Mean and standard deviation values ... focus is on a detailed analysis of selected data for the conventional joystick, related to the aim of identifying sensitive assessment metrics; most of the other data was used as part of the Master's...
- 15
- 361
- 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
Ngày tải lên :
20/06/2014, 01:20
... Mortality was corrected according to Abbott 's formula [23] Statistical analyses Probit analysis of mortality data from bioassays was conducted using SPSS (ver10.0) computer software (SPSS for ... baculoviral infection in larval shrimps as well as insects [9-13,7,14-19] Because baculoviruses are of great interest and utility to a large cross-sections of agricultural and biomedical research ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG...
- 11
- 854
- 0
Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc
Ngày tải lên :
20/06/2014, 01:20
... obtained by plaque assay and expressed as PFU/ml are shown on the top of the bars Because the current version of the Platelia™ Dengue NS1 AG assay was primarily designed to discern qualitatively ... conclusion, our data suggest that the Platelia™ Dengue NS1 AG assay can be use as a surrogate, easy and fast method for the semiquantitation of DEN in cultured cells Reliable levels of NS1 protein ... immunoassay for the qualitative or semi-quantitative detection of dengue NS1 antigen in human sera or plasma The test uses murine monoclonal antibodies for capture and revelation The assay was carried...
- 8
- 383
- 0
báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt
Ngày tải lên :
20/06/2014, 04:20
... optimal codon usage for expression in mammalian cells and all potential polyadenylation sites (AATAAA) and splice donor sites (AGGT) removed essentially as described [15] A similar construct was ... coturnix japonica (Japanese quail), fibrosarcoma Tadarida brasiliensis (free-tailed bat), lung Mus musculus (mouse), fibroblast Mesocricetus auratus (Syrian golden hamster), kidney Oryctolagus cuniculus ... protein This assay has multiple applications For example, this assay can be used as a means of studying the structure -function of the HRSV F protein, or for evaluating the activity of mutations in...
- 12
- 541
- 0
báo cáo hóa học:" Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pot
Ngày tải lên :
20/06/2014, 16:20
... user-manual, presenting norms of larger CA population samples Our study has a limitation in that data assessed at months are based on a relatively small sample size (n = 41–42) Larger sample sizes ... the data analysis Severity of disease was derived from the TISS (Therapeutic Intervention Scoring System) scores The TISS is a well- Table 2: General characteristics of patients and parents Patients ... factual intensity of nursing care in a hospital setting [27,28] In our department TISS is used as a standard assessment score (see Table 2) Design This is a prospective, longitudinal study comprising...
- 10
- 366
- 0
USE OF A SOAKING PROCEDURE TO IMPROVE DRY BEAN ATTRIBUTES - MILESTONE 7 pdf
Ngày tải lên :
21/06/2014, 06:20
... been soaked in water, prior to drying is less than that of beans which haven’t been soaked Again this is desirable from the industry stand point as shell is a waste product Summary Results presented ... and this results in brown bean percentages acceptable to buyers In comparable countries such as Malaysia or Indonesia, seven days pod storage and six day fermentation periods are also generally ... presented indicated that the desirable attributes of less acidity, higher brown bean percentages and less shell were obtained by using the soaking procedure Sensory analysis of samples was not conducted...
- 22
- 220
- 0
Cutting Tool Materials What is the use of a book docx
Ngày tải lên :
27/06/2014, 23:20
... practice, to facilitate the rate of transformation in the reaction chamber, additions of solvents/catalysts are utilised for synthesis at more easily obtainable levels: pressures of approximately ... All this sounds quite confusing, but basically the ‘Sialon’ microstructure consists of a crystalline nitride phase, held in a glassy, or partially crystallised matrix These crystalline grains ... mechanical/physical characteristics of cemented carbides, it is worth looking into the complex task of insert selection In Fig 4, just a small range of the material types, grades, shapes of inserts and coatings...
- 31
- 455
- 0
