from marsh c j amp willis g 2003 curriculum alternative approaches ongoing issues 3rd ed upper saddle river nj merrill prentice hall
Bài thuyết trình sự khác nhau giữa c++ trong windows và g++ trong linux
Ngày tải lên :
20/08/2013, 15:35
... ứng dụng chạy, quản lý thông tin người dùng, quản lý liệu đĩa c ng… Trình biên dịch C Linux phần GCC (GNU Compiler Collection).GCC dùng với: C, C+ +,Objective C, Fortran, … Biên dịch C "gcc" Xem ... hình Biên dịch C+ + "g+ +" • • • • • • Bộ c ng c phát triển ứng dụng GNU * GNU Compiler Collection (GCC) + Thư viện hàm tiện ích: libc, libstdc++, … + C c trình biên dịch gcc, g+ +, gcj, gas, … + ... Tùy chọn " -c" : - Giúp trình biên dịch file thủ t c tạo object file (tất nhiên chương trình chạy, m c định!) File object c phần mở rộng ".o" ".obj" + Ví dụ: ~$ gcc -c -o hello hello .c • Tùy chọn...
- 18
- 869
- 2
Bose einstein condensation in dilute gases pethick c j , smith h
Ngày tải lên :
24/01/2014, 17:30
... Feshbach resonance, by changing the strength of an applied magnetic or electric field A further advantage is that, because of the low density, ‘microscopic’ length scales are so large that the structure ... helium reduce dramatically the occupancy of the lowest single-particle state led to the search for weaklyinteracting Bose gases with a higher condensate fraction The difficulty with Introduction ... atomic hydrogen Initial experimental attempts used a high magnetic field gradient to force hydrogen atoms against a cryogenically cooled surface In the lowest-energy spin state of the hydrogen...
- 414
- 430
- 0
Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt
Ngày tải lên :
07/03/2014, 12:20
... initiating ATG underlined) in combination with antisense primers introducing a stop codon sequence: mGRK6-A M2: P2, 5¢-CTAGTCGC TGGAGTTCCCAGAGGAATCTTGGCG-3¢ (nucleotides 1677–1706, antisense, stop codon ... C for min, followed by a single incubation at 72 C for 10 min) using primer P1, 5¢-CGCCA AGATTCCTCTGGGAACTCCAGCGACAGT-3¢ (nucleotides 1677–1709, sense) in combination with primer P2, 5¢-ACTGTCGCTGGAGTTCCCAGAGGAATCTTGG ... mGRK6-A cDNA by PCR (30 cycles: 94 C for min, 70 C or 62 for min, 72 C for min, followed by a single incubation at 72 C for 10 min) using primer P1, 5¢-AGCCCATGGAGCTCGAGAACA TCGTA-3¢ (nucleotides...
- 13
- 424
- 0
C++ Lab 13 SORTI G Dr. John P. Abraham docx
Ngày tải lên :
08/03/2014, 00:20
... = getScores(scores); //go get the scores and how many cout
- 6
- 307
- 1
released from the grip of what he carried freedom from his c
Ngày tải lên :
21/03/2014, 22:49
... infantry, carries not only hatchet with which he cuts off a thumb of an enemy Harry Dobbins carried his girlfriend's panties around his neck, and Dave Jansen carried ear plugs.Throughout the story, Cross' ... of one of his men Cross felt that it was because of his daydreaming that Ted Lavender died After Lavender died, Cross began to think about his actions He realized that throughout the war, he ... time dreaming of a woman he hardly knew How she herself had no special feelings for Cross and she was just writing to him because she felt a responsibility to Although seemingly reaching out to...
- 2
- 245
- 0
Báo cáo khoa học: Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspecific cross-reacting antigen doc
Ngày tải lên :
23/03/2014, 05:22
... 5¢ VH3–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CGAGGTGCAGCTGGTGGAGTCTGG-3¢; 5¢ VH4–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTGCAGCTGCAGGAGTCGGG-3¢) and one forward primer (CH2FORTA4) These ... designed to anneal on human VH genes (5¢ VH1–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTGCAGCTGGTGCAGTCTGG-3¢; 5¢ VH2–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTCACCTTGAAGGAGTCTGG-3¢; ... TGGCGGCCGAGGTGCAGCTGGTGG) and 3¢ c- myc– 6His ⁄ HindIII (CCGCGCGCGC CAAGACCCAAGCTTG GGCTARTGRTGRTGRTGRTGRTGTGCGGCCCCAT TCAGATC) to add the HindIII site for further cloning, a hexahistidine tag for purification...
- 13
- 529
- 0
computational geometry in c - j o'orourk
Ngày tải lên :
31/03/2014, 16:12
... Computational Geometry in C scan By Tracy Wang February 16, 2004 ...
- 358
- 314
- 0
schrijver c.j., zwaan c. solar and stellar magnetic activity
Ngày tải lên :
24/04/2014, 17:00
... Solar magnetic configurations Active regions The sequence of magnetoconvective configurations Flux positioning and dynamics on small scales The plage state Heat transfer and magnetic concentrations ... impossible to justice to these experiences here We can explicitly thank the colleagues who critically commented on speci c chapters: V Gaizauskas (Chapters 1, 3, 5, 6, and 8), H C Spruit (Chapters ... Schwarzschild criterion Eq (2.21) indicates instability, convective motions develop There are two commonly used approaches to the modeling 2.2 Convective envelopes: classical concepts 17 of convection...
- 396
- 270
- 0
![physics in daily life [coll. of newspaper columns from europhysics news] - j. hermans (edp, 2012) ww](https://media.store123doc.com/images/document/14/y/or/medium_orn1399113492.jpg)
physics in daily life [coll. of newspaper columns from europhysics news] - j. hermans (edp, 2012) ww
Ngày tải lên :
03/05/2014, 17:38
... mechanical power, schematically 13 Moving around efficiently E ver considered the efficiency of a human being moving from A to B? Not by using a car or a plane, but just our muscles Not burning ... have never guessed that time would be measured with such an astonishing accuracy just a century later As an example, think of GPS satellite clocks: to enable us to navigate with accuracies on the ... metres, their clocks have to be precise within nanoseconds And in laboratories around the globe, laser-cooled Cesium and Rubidium fountain clocks reach an incredible fractional accuracy of about...
- 113
- 240
- 0
from an ontological point of view jun 2003
Ngày tải lên :
10/06/2014, 23:16
... according to which objects and properties are components of a compound entity joined together by a kind of metaphysical superglue Once we move beyond this conception we can recognize an object—this ... a pickled egg, or had you not believed there were pickled eggs in the jar,you would not have reached for the jar.Perhaps, so the thinking goes, this is as close as we can come to attaching causal ... answering to projectable predicates—ought to have ‘causal relevance’, and the conviction that many properties satisfying projectable predicates—mental properties, for instance—lack causal relevance...
- 284
- 258
- 0
university of wales press a history of money from ancient times to present day feb 2003
Ngày tải lên :
11/06/2014, 13:58
... among critics of the fact that the enjoyable, enthusiastic and argumentative process of prolonged bargaining was very much the prime object of the exercise – the actual exchange being something ... including especially the French economist, Turgot, to conclude that anything can in actual practice act as money One must admit that in any logical (not chronological) list of monetary functions, ... readily acceptable stable monetary unit useful for the longer-term contracts required for the capital goods especially desired by the developing countries In such circumstances the direct exchange...
- 741
- 486
- 1
FINITE DIFFERENCE SCHEMES WITH MONOTONE OPERATORS N. C. APREUTESEI Received 13 October 2003 and in doc
Ngày tải lên :
23/06/2014, 00:20
... the weak convergence and by “→” the strong convergence in H For every maximal monotone operator A and the scalar λ > 0, we may consider the single-valued and everywhere-defined operators J and ... − uλ−1 is a Cauchy sequence with respect to λ Subtracting (3.20) i i with ν in place of λ from the original equation (3.20), multiplying the result by (uλ − i uν ), and summing up from i = to ... particular case of (3.20), where D(β) is bounded, we can use λ λ the proof of Theorem 3.2 to deduce the boundedness of v1 and vN in H with respect to λ Hence, there exist two constants C1 and C2 ...
- 12
- 178
- 0
Project Gutenberg''''s Show Business, by William C. Boyd and Lyle G. Boyd pptx
Ngày tải lên :
28/06/2014, 17:20
... copying and distributing Project Gutenberg-tm electronic works to protect the PROJECT GUTENBERG-tm concept and trademark Project Gutenberg is a registered trademark, and may not be used if you charge ... Science Fiction November 1953 Extensive research did not uncover any evidence that the U.S copyright on this publication was renewed Minor spelling and typographical errors have been corrected ... resolve, I chuckled The picture of a tllooll trying to ride a fourwheeled bicycle, pumping each of his eight three-jointed legs up and down in turn, while maintaining his usual supercilious and...
- 84
- 316
- 0
Test J-Thi tuyen-G.10-G.9-2010
Ngày tải lên :
10/07/2014, 17:00
... beginning C C C C C C C C neighbors twice at mausoleums if impressed energetic middle D D D D D D D D pen pals fourth for rivers because impress commercial finish QUESTION VI Read the passage ... business A A compliment C using the internet D reading a magazine C Yes, very often D rarely C pronunciation D writing C watching TV Yes, several times three years ago D long ago he need to improve? ... and choose the best answer (A, B, C or D): Dear Sir or Madam, • I saw your advertisement for English classes in this month’s English Today magazine and I am interested in coming to your school...
- 3
- 267
- 0
