flow a bonnet dechaume blanc wyburn mason syndrome b sturge weber syndrome c klippel trenaunay syndrome d parkes weber syndrome e rendu osler weber syndrome
a. ever were put b. were ever putted c. were ever put d. ever were putted c 11. The ships had ppt
... United States and Europe well before the Second World War a < /b> were conducting b have been conducted c had been conducted d being conducted > c 22 billions and billions of stars exist in the vast ... found c have occasionally been found d have occasionally found > c 62 Between the California Coast Range and the Sierra Nevada a < /b> great Central Valley b the great Central Valley c being the ... Don't handle those cups and saucers as if they made of iron a < /b> are b were c has been d had been > b 178 I am standing where I the game a < /b> can see b could see c can't see d couldn't see > a < /b> 179...
- 28
- 412
- 0
Báo cáo hóa học: " Gait kinematic analysis in patients with a mild form of central cord syndrome" pdf
... with CCS For each subject, each computed parameter was calculated as the average of the values obtained in the five trials considered A < /b> descriptive analysis was made of the clinical and functional ... were helped to walk more slowly with vocal commands Five valid trials were collected for each patient at a < /b> self selected speed and for CG at a < /b> self selected speed and at slow speed to reduce ... variables by calculating the mean and standard deviation of the quantitative variables and the frequencies and percentages of the qualitative variables The normality distribution was checked...
- 10
- 440
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" pot
... Authors’ contributions MS and CK conceived the project and conducted the primary literature review and manuscript composition HK and DK contributed additional data to the literature review and manuscript ... Using a < /b> sterile marker, we marked the needle insertion site one centimeter cephalad to the greater trochanter A < /b> 25-gauge, 1-1/2 inch needle was used to infiltrate the skin with 1% lidocaine Subsequently, ... symptoms arose directly from the articular surfaces of her hips, and possibly from the bilateral impingement of her lateral femoral cutaneous nerves, as a < /b> result of her inadequately developed acetabula...
- 5
- 462
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" ppt
... Authors’ contributions MS and CK conceived the project and conducted the primary literature review and manuscript composition HK and DK contributed additional data to the literature review and manuscript ... Using a < /b> sterile marker, we marked the needle insertion site one centimeter cephalad to the greater trochanter A < /b> 25-gauge, 1-1/2 inch needle was used to infiltrate the skin with 1% lidocaine Subsequently, ... symptoms arose directly from the articular surfaces of her hips, and possibly from the bilateral impingement of her lateral femoral cutaneous nerves, as a < /b> result of her inadequately developed acetabula...
- 5
- 393
- 0
Báo cáo khoa học: "Role of mucosal mast cells in visceral hypersensitivity in a rat model of irritable bowel syndrome" ppt
... M, Neal KR Increased rectal mucosal enteroendocrine cells, T lymphocytes, and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome < /b> ... Korea) was inserted intra-anally until the end of the balloon was cm inside the rectum Rats were placed in a < /b> transparent cubicle (20 × × cm) on a < /b> mirror-based elevated platform and were allowed ... the day of experiments, rats were sacrificed by cervical dislocation and the distal colon was dissected The colonic samples were fixed in Carnoy’s fixative for hr at room temperature, and then...
- 6
- 321
- 0
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc
... GTTTCCGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAG B tŝůĚ ƚLJƉĞ ƐĞƋƵĞŶĐĞ TCTGGGCTTCTTGCATTCTGGGACAGCCAAGTC NEW cDNA SEQUENCE GENERATED BY THE INSERTION OF NUCLEOTIDES: codon TGG CCC CTG TCA TCT TCT GTC CCT TCC CAG AAA ACC TAC CAG ... wild-type allele; the red bracket indicates the nucleotide sequence that is duplicated The lower sequence corresponds to the mutated allele, and the asterisk and red box indicates the inserted/duplicated ... TP53 exon for the index patient Bold underlined indicates the duplicated sequence, below which the wild-type sequence is shown B Changes in the cDNA sequence: new cDNA sequence (bold) and generation...
- 7
- 403
- 0
Báo cáo y học: "Acute Complex Type A Dissection associated with peripheral malperfusion syndrome treated with a staged approach guided by lactate levels" ppt
... delaying intervention in anticipation of clinical signs Differentiating between bowel ischemia and lower limb ischemia in the absence of clinical signs and a < /b> raised lactate can be based on radiological ... this weak part of the aortic wall A < /b> 28 mm Dacron conduit was then anastomosed (hemiarch replacement) and the patient was rewarmed to 37 C The chest was packed and left open for delayed closure, ... bifurcation (Figure 1a < /b> and Figure 2a)< /b> No contrast could be visualized in the native iliac arteries and there was reduced blood flow < /b> in the celiac axis and the primary branches of the superior mesenteric...
- 5
- 389
- 0
Báo cáo y học: " Control of disseminated intravascular coagulation in Klippel-Trenaunay-Weber syndrome using enoxaparin and recombinant activated factor VIIa: a case report" pptx
... febrile and bacteremic at 38 days after the operation Triggered by bacteremia with Citrobacter youngae and Enterococcus faecalis, DIC recurred and bleeding resumed 40 days after the operation ... MLS edited the manuscript All authors analyzed and interpreted the patient data regarding the hematological disease and its management All authors read and approved the final manuscript Competing ... therefore begun on day 29 The bleeding abated abruptly, hence transfusions of blood products were no longer needed (Figure 1) The bleeding was Page of controlled until the patient became febrile...
- 4
- 294
- 0
Báo cáo y học: "Simultaneous sleep study and nasoendoscopic investigation in a patient with obstructive sleep apnoea syndrome refractory to continuous positive airway pressure: a case report" ppt
... This approach must be made and addressed specifically Case presentation We report a < /b> 38-year-old Caucasian man who was referred to our department for suspected OSAS with complaints of severe snoring, ... community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp ... CL analyzed and interpreted the patient data regarding OSAS and reviewed the existing literature on this issue MD also analyzed and interpreted the patient data and was a < /b> major contributor in...
- 7
- 359
- 1
Báo cáo y học: " A rare case of neuroleptic malignant syndrome presenting with serious hyperthermia treated with a non-invasive cooling device: a case report" potx
... extracorporeal circulation After the patient’s haemodynamic condition had been stabilized, extracorporeal renal support became necessary later because of acute renal failure probably due to rhabdomyolysis ... exclude, on the one hand, any cause of infection and, on the other hand, a < /b> cerebral cause for decreased awareness and autonomic dysregulation The cerebral CT scan and the cerebrospinal fluid analysis ... rare case of excessive hyperthermia caused by neuroleptic malignant syndrome,< /b> the fast cooling therapy probably reduced residual impairment and may have even been lifesaving We therefore believe...
- 5
- 253
- 0
Báo cáo y học: "A possible variant of Bouveret’s syndrome presenting as a duodenal stump obstruction by a gallstone after Roux-en-Y gastrectomy: a case report" pot
... manuscript AR performed a < /b> literature review and helped draft the manuscript SA conceived the study All authors have read and approved the final manuscript References Cappell MS, Davis M: Characterization ... obstruction and extrinsic bile duct compression After he was admitted to a < /b> specialist centre, endoscopic ultrasonography and repeat ERCP were attempted but failed due to inability to cannulate ... and found to be normal, and contained no stones The gallstone in the duodenum was extracted via a < /b> duodenotomy, the duodenal stricture was dilated digitally and a < /b> cholecystectomy was performed...
- 3
- 271
- 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... Our findings of increased cerebral vascular accidents in patients with sickle cell disease and asthma may be due to their increased and recurrent episodes of acute chest syndrome < /b> The mechanism ... lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited ... chest syndrome < /b> in 38 children revealed that intravenous dexamethasone prevented clinical deterioration in mild to moderately severe episodes of acute chest syndrome < /b> [14] Mild and moderately severe...
- 5
- 288
- 0
Báo cáo y học: "Increasing arterial blood pressure with norepinephrine does not improve microcirculatory blood flow: a prospective study" potx
... norepinephrine infusion was augmented Heart rate, DO2 and oxygen consumption remained unchanged (Table 2) Effects on lactate and acid-base parameters Arterial lactate levels were stable Venous oxygen saturations ... al Dunnett test Linear trends between the different variables and increasing levels of MAP were calculated [25] A < /b> P < 0.05 was considered significant Data are showing as mean ± standard deviation ... were verified, and images of poor quality were discarded The entire sequence was used to characterize the semi-quantitative characteristics of microvascular blood flow,< /b> particularly the presence...
- 8
- 283
- 0
Culture Flow A Social Influence Marketing Framework
... The brand will be re-imagined and re-energized • New online database can be created to capture preference information and user generated content to better target your products • The more consumers ... broken the traditional model, and marketers are now faced with a < /b> complex social ecosphere • Social networks have given consumers more power • Linear communication, carefully controlled by brands, ... marketing strategies and tools are typically chosen • Shout marketing, not conversations dominate messaging • Brand assets / content are “protected” inside the walled garden ENGAGEMENT • Broad...
- 11
- 190
- 0
Đánh giá hiệu quả thương mại và tính giá trị gia tăng, thặng dư xã hội do dự án đem lại cho nền kinh tế quốc dân của dự án đầu tư vào khai thác mỏ Felspat (Sơn Mã – Lào Cai) t.doc
... thể bị sai lệch hai hay nhiều d ̣ a< /b> n có cùng tiềm lư c đem so sánh thời gian phát sinh cu a < /b> ca c khoản lãi thư c kha c Phương pháp này chỉ chú trọng xa c định doanh lợi cu a < /b> ... kinh nghiệm a< /b> qua và ca c hội đầu tư kha c cu a < /b> chủ đầu tư Trong số ca c d ̣ a< /b> n đem so sánh, d ̣ a< /b> n nào có T lớn nhất sẽ đươ c lư a < /b> chọn Ưu, nhươ c điểm cu a < /b> chỉ tiêu: Sinh ... và dịch vụ chế thị trường đòi hỏi phải triển khai ca c d ̣ a< /b> n đầu tư có sở khoa ho c d a < /b> sự phân tích tính toán chặt chẽ Thư c tế chỉ rằng, thành c ng hay thất bại của...
- 24
- 1,141
- 3
Một số giải pháp nhằm phòng ngừa và hạn chế rủi ro trong phương thức tín dụng chứng từ tại các công ty xuất nhập khẩu Việt Nam.doc
... thư c tín dụng chứng từ(international Standard Banking Practice for examination of documents under documentary credits-ISBP 645,đươ c b ̉ sung sư a < /b> đổi theo UCP 600,do ICC phát hành tháng ... shipment must be effected not later than ghi time of delivery: latest December 31st, 2000 or earliest September 1st, 2001 * Trong vòng : shipment must be effected during * Khoảng: shipment must be ... coi hợp lệ L /C có quy định chấp nhận chứng từ b n thứ ba lập: commercial invoice issued by third party is acceptable hay third party acceptable - Mô tả hoá đơn phải quy định L /C - Số lượng,...
- 43
- 867
- 0
Phân tích sự thay đổi điển nhìn của nhà văn Nam Cao trong các truyện ngắn: Đời thừa, Đón khách, Trăng sáng, Bài học quét nhà, Nước mắt
... Website: http://www.docs.vn Email : lienhe@docs.vn Tel : 0918.775.368 sống ngời C thể nói, d viết ngời trí th c nghèo hay ngời nông d n khổ Nam Cao day d t tới đau đớn tr c tình trạng ... Điền bao anh trí th c nghèo, c h c th c mà h c th c chẳng làm cho anh sung sướng hơn, sống c nh túng quẫn, lo toan c m áo chẳng làm cho người th c hoài b o ư c mơ, phát huy tài vốn c Website: ... phải qua quán nư c nhà c Na thành quen gia đình c c Sinh thường hay chêu ghẹo Na, làm Na b đồ tưởng đâu Sinh th c lòng thích Na thật, chò đ a < /b> thật tai c mà Sinh không nghĩ thật, Nam Cao miêu...
- 10
- 1,912
- 25
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25