fl 7th c wife of muhammad

Tài liệu Advanced Linux Programming: C Table of Signals ppt

Tài liệu Advanced Linux Programming: C Table of Signals ppt

Ngày tải lên : 21/01/2014, 07:20
... in Chapter 3, “Processes.” SIGXCPU Linux sends a process this signal when it exceeds the limit of CPU time that it can consume See Section 8.5, “getrlimit and setrlimit: Resource Limits,” in Chapter ... pointer” can cause a SIGSEGV SIGPIPE The program has attempted to access a broken data stream, such as a socket connection that has been closed by the other party SIGALRM The alarm system call schedules ... a process terminate.This is the default signal sent by the kill command SIGCHLD Linux sends a process this signal when a child process exits See Section 3.4.4, “Cleaning Up Children Asynchronously,”...
  • 2
  • 453
  • 0
Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt

Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt

Ngày tải lên : 25/01/2014, 19:20
... C: INTRODUCTION OF C PROGRAMMING FOR DSP APPLICATIONS C program (Source) Preprocessor Compiler Assembly code Assembler Object code Linker (loader) Libraries Execution Data Output Figure C. 1 C. 1 ... the C compiler The #define directs the preprocessor to replace subsequent occurrences of K with the constant value 1024 A C program may consist of one or more functions and one and only one function ... interpret include files, and check conditional compilation Preprocessor directives give instructions to the compiler that are performed before the program is compiled Each preprocessor directive begins...
  • 18
  • 505
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Ngày tải lên : 16/02/2014, 14:20
... in cell biological studies, the mechanism of PDI inhibition by bacitracin is unknown We have recently speculated that inhibition could arise because of one of two effects [30] First, bacitracin ... directly to inhibition of PDI-catalyzed insulin reduction Fig Effects of bacitracin and other compounds on the relative rate of reduction of the B-chain of bovine insulin Insulin was reduced ... presence of bacitracin In the insulin reduction assay, bacitracin was able to decrease the activity of PDI in a concentration-dependent manner, but this effect was small, such that, in the presence...
  • 9
  • 620
  • 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Ngày tải lên : 19/02/2014, 05:20
... the structure of the A state of cytochrome c Biochemistry 39, 12632– 12638 18 Sinibaldi F, Howes BD, Smulevich G, Ciaccio C, Coletta M & Santucci R (2003) Anion concentration modulates conformation ... horse cytochrome c The expression plasmid of horse cytochrome c was introduced into Escherichia coli JM 109 strain; bacterial expression and purification of the recombinant protein were then conducted ... Fig Fig Absorbance at 695 nm of acid-denatured cytochrome c in the presence of increasing sulfate (s) and selenate (d) concentrations The optical absorbance of native cytochrome c (—) at pH 7.0...
  • 11
  • 487
  • 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Ngày tải lên : 19/02/2014, 12:20
... individual chains resulting from decrease in chain length, as evidenced by decreased molecular mass of LMWC The DA calculated using 13 C- NMR spectra was in accordance with the one calculated by IR-spectra ... lysis of the bacterial cells as evidenced by SEM (unpublished observations) Characterization of the mono-oligomeric mixture Fig Circular dichroic (CD) spectra of chitosan and LMWC resulted in LMWC ... of reducing groups indicating action of pronase on -GlcNAc-GlcN-linkage resulting in the products (LMWC and oligomers) with GlcNAc at reducing ends In addition, the presence of GlcNAc in Fraction...
  • 11
  • 673
  • 0
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Ngày tải lên : 19/02/2014, 16:20
... the Ca atoms of cK18, cI19, cT20 and cK21, and the second group Ca atoms of cD233, cN234, cA235 and cS236 The magnitude and direction of the forces was calculated at every step of the molecular ... from the N-end of c subunit (cA1–cK24) and 43 residues from its C- end (cT230– cL272) The chosen portion included a major part of the coiled-coil region of c and the complete a-helical C- terminus ... the coiled-coil portion of c at the level of cK18–cK21 and cD233–cS236 residues The torque was created by external forces acting on the two groups of four carbon atoms each The first group included...
  • 9
  • 546
  • 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Ngày tải lên : 19/02/2014, 18:20
... resulting plasmid by cloning the following annealed oligonucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGTTCGCGACCGCCCTGACGGCGATTA TCGGAGTTCGGACA-3¢ into the ... and EcoR1-digested p13R4 The same strategy was used for constructing p13R4-P, except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGATCCTAGCA ... primers 5¢-GTCTGGCGGAA AACCTCAGTGTGACGC-3¢ and 5¢-GACACCAGACCA ACTGGTAATGGTAGCGACCG-3¢ were used for the amplification of the 3¢ end of the b-gal gene The presence of similar amounts of genomic DNA in...
  • 14
  • 483
  • 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Ngày tải lên : 21/02/2014, 01:21
... monophasic shape are Table Rates of inactivation of IICBGlc Incubation of purified IICBGlc with the indicated concentration (mM) of the analogues 1a)3d was carried out at 30 C Rate constants ... glucose receptor of the bacterial phosphotransferase system: molecular cloning of ptsG and purification of the receptor from an overproducing strain of Escherichia coli Proc Natl Acad Sci USA 84, ... bromoacetic acid and 2.5 times faster than by the chemically more reactive iodoacetamide, suggesting some specificity and selectivity of the glucose analogues for EIIGlc Phosphorylation of EIIGlc completely...
  • 12
  • 720
  • 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Ngày tải lên : 21/02/2014, 15:20
... pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase expressing construct, a 173-bp PCR fragment of the CK2btes gene including ... ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned as a fusion with GAL4bd in the pAS2-1 vector (Clontech, La Jolla, CA, ... of D melanogaster CK2a gene comprising the whole ORF region was PCR-amplified from Drosophila genomic DNA using the following pair of primers: 5¢-CAGGATCCATGACACTTCCTAGTGCG GCTCGC-3¢ and 5¢-CCAAGCTTTTATTGCTGATTAT...
  • 10
  • 464
  • 0
Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Ngày tải lên : 06/03/2014, 22:21
... Temperature dependences of the excess heat capacity (Cp) of intact (curve 1), ECP-cleaved (curve 2) and subtilisin-cleaved (curve 3) ATP-Ca-G-actins The actin concentration was 24 lM Other conditions: ... values of Tm did not exceed ± 0.2 C The relative error of the given values of DHcal did not exceed ±10% Mg-F-actin Stabilizer Tm ( C) DHcal (kJÆmol)1) Intact Intact Intact Intact ECP-cleaved ECP-cleaved ... ATPMg-G-actins Fig DSC curves of intact G-actin (A) and ECP-cleaved G-actin (B) with different tightly bound nucleotide and cation: ATP-Ca-Gactin, ATP-Mg-G-actin and ADP-Mg-G-actin The actin concentration...
  • 11
  • 482
  • 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Ngày tải lên : 07/03/2014, 12:20
... 5¢-GTCTCCAGACGTCTCGAAC-3¢; reverse, 5¢-CATCCAAGTCTTGGGAGCTC-3¢ For NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG TC-3¢ For NKA49: forward, 5¢-CTTCCACGACGGAAAC GATGAC-3¢; ... number DQ017261): 5¢-GATGCATAATACGACTCACTATAGG GAAATGTCCGTCCAACAAGGAG-3¢ (forward) and 5¢GCCTTCTAATACGACTCACTATAGGGACCACGATG ATGGATGAAATG-3¢ (reverse) Both primers contained T7-polymerase promoter ... GATGAC-3¢; reverse, 5¢-CTCTCCAACACATGCTGACG TAG-3¢ Cycling conditions were 94 C for min, followed by 35 cycles of 94 C for 30 s, 54 C for 30 s, 72 C for min, and 72 C for 10 The samples were...
  • 10
  • 639
  • 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Ngày tải lên : 07/03/2014, 15:20
... ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
  • 9
  • 414
  • 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

Ngày tải lên : 07/03/2014, 21:20
... Japan Science and Technology Agency (Creation of Bio-devices and Biosystems with Chemical and Biological Molecules for Medicinal Use) and Grants-in-Aid for Scienti c Research from the Ministry of ... gp41 molecule as 41S-2-L was [10,11] In some cases, a significant change in the immunological character of the heavy or light chain could occur, resulting in a different specificity from that of the ... (RSSHFPYSQYQFWKNFQTLK) derived from CCR5, a chemokine receptor, which plays a crucial role in HIV infection In all of these catalytic antibodies, a catalytic triad composed of Asp, Ser, and His was always...
  • 9
  • 388
  • 0
The Benefi ts of Biotechnology: Scientifi c Assessments of Agricultural Biotechnology’s Role in a Safer, Healthier World

The Benefi ts of Biotechnology: Scientifi c Assessments of Agricultural Biotechnology’s Role in a Safer, Healthier World

Ngày tải lên : 13/03/2014, 21:57
... low-phytate crops Nature Biotechnology 25: 874-875 47 Brookes & Barfoot, 1996-2006 48 Council for Agricultural Science and Technology (CAST) 2007 Implications of Gene Flow in the Scale-up and Commercial ... individual biotech crop genetic event and to address the “legitimate concerns for the biosafety of each product and process prior to its release.”5 Rising Food Costs Prices of agricultural food commodities ... than is considered acceptable The total cost of food imported by the neediest countries rose 25 percent in 2007.7 Some Blame African Hunger on Rejection of Agricultural Biotechnology According...
  • 28
  • 286
  • 0
Ecient Collision Detection for Animation and RoboticsMing C. LinDepartment of Electrical pptx

Ecient Collision Detection for Animation and RoboticsMing C. LinDepartment of Electrical pptx

Ngày tải lên : 14/03/2014, 14:20
... described in the next section However, the basic concept of CSG representation is used in constructing the subpart hierarchical tree to describe the nonconvex polyhedral objects, since each convex ... interactive, realistic virtual environment The objective of collision detection is to automatically report a geometric contact when it is about to occur or has actually occurred It is typically ... exact contact points when collisions occur Parts of this chapter represent joint work with Dinesh Manocha of the University of North Carolina at Chapel Hill Chapter complements the previous chapters...
  • 159
  • 296
  • 0
Báo cáo khoa học: Voltage-gated sodium channel isoform-specific effects of pompilidotoxins doc

Báo cáo khoa học: Voltage-gated sodium channel isoform-specific effects of pompilidotoxins doc

Ngày tải lên : 15/03/2014, 10:20
... respectively (D) Conductance–voltage plots obtained in controls (closed squares) and in the presence of toxin with 46 lM b-PMTX (solid circles and triangles) The fractional conductances of the ... obtain EC50 values (i.e the toxin concentration that produces 50% of the maximum effect) at three voltages Conductances of the fractional components were shown as a function of voltage Each experiment ... Biosciences of the University of Milano-Bicocca References Catterall WA, Goldin AL & Waxman SG (2005) International Union of Pharmacology XLVII Nomenclature and structure–function relationships of...
  • 13
  • 364
  • 0
Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Ngày tải lên : 16/03/2014, 00:20
... 832–838 Nichesola D, Perduca M, Capaldi S, Carriso ME, Righetti PG & Monaco HL (2004) Crystal structure of chicken liver basic fatty acid-binding protein complexed with cholic acid Biochemistry ... according to established protocols [50] Experimental protocols were reviewed by the Animal Care Committee of Dalhousie University in accordance with the recommendations of the Canadian Council ... (2001) Cloning and sequence of the gene encoding the muscle fatty acid binding protein from the desert locust, Schistocerca gregaria Insect Biochem Mol Biol 31, 553–562 18 Ceciliani F, Monaco HL,...
  • 11
  • 402
  • 0
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Ngày tải lên : 16/03/2014, 02:20
... two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) and PMluI (5Â-GTACACGCG TCTGATCAG-3Â) were inserted into the 3Â-end of the pYES2VPP plasmid ... translocation Truncation of the C- terminus induces a dramatic decline in V-PPase enzymatic activity, proton translocation, and coupling efciency [9] In addition, deletion of the C- terminus of V-PPase ... membrane Solid circle, luminal side; dotted circle, cytosolic side Inset: section of a lipid bilayer with thickness of 4.6 0.5 nm (n = 12) (C) Prole of protrusion heights along the cross-section shown...
  • 14
  • 332
  • 0
Báo cáo khoa học: The Janus-faced atracotoxins are specific blockers of invertebrate KCa channels ppt

Báo cáo khoa học: The Janus-faced atracotoxins are specific blockers of invertebrate KCa channels ppt

Ngày tải lên : 16/03/2014, 06:20
... that J-ACTX-Hv 1c selectively blocks cockroach BKCa channels rather than small-conductance KCa channels (SKCa channels, KCa2.x) and intermediate-conductance KCa channels (IKCa channels, KCa3.x) ... of macroscopic IK by lM J-ACTX-Hv 1c (D) Typical block of IK(Ca) by increasing concentrations of ChTx (in nM) Subsequent addition of TEA in the presence of 30 nM ChTx abolished the remaining current, ... Block of IK(Ca) occurred without significant alteration of the A D B E C F Fig J-ACTX-Hv 1c blocks KCa channels in cockroach DUM neurons (A) Typical effects of nM J-ACTX-Hv 1c on IK(Ca), showing...
  • 15
  • 319
  • 0