... and mixed with 11 2 12 5 and 11 9– 13 2 actin peptides As shown in Fig 8B, the 11 9 13 2 peptide does not perturb FITC In contrast the 11 2 12 5 peptide induces a fluorescence decrease of the label, but ... sequences Peptide 15 9 19 3 Kd ELISA Peptide 15 9 19 3 Kd fluorescence Cofilin Kd Reference for cofilin Actin G Actin F 1 10 18 28 84 10 3 11 2 12 5 11 9 13 2 347–365 338–348 360–3 72 355–375 1. 3 mM ND No binding ... Two peptides belonging both to the 11 4 22 5 sequence and exposed regions of subdomain were tested (11 2 – 12 5 and 11 9 – 13 2 peptides) Interaction of the 15 9 19 3 fragment with the coated peptides...
... Sugimura, T (19 90) 24 25 26 27 28 29 30 Calyculin A, an inhibitor of protein phosphatases, a potent tumor promoter on CD -1 mouse skin Cancer Res 50, 35 21 3 525 Li, Y.-M & Casida, J.E (19 92) Cantharidin-binding ... inhibitors of PP1 and PP2A [23 ,24 ], showed effects similar to that of OA (Fig 4) Deltamethrin, a specific inhibitor of PP2B [25 ], and phenylarsine oxide, a putative inhibitor of tyrosine phosphatases [26 ], ... IMAGING SYSTEM and, for each condition, the ratio Glu/Tyr was calculated A/B ¼ 0 .17 ± 0.03; C/D ¼ 1. 21 ± 0 .15 ; E/F ¼ 0 .28 ± 0.04; G/H ¼ 1. 12 ± 0 .17 Each value represents the mean ± SE of four independent...
... July 1, 19 98 and was abolished by the Legislature on July 1, 20 02 This is trial version www.adultpdf.com Chapter 1: Introduction Exhibit 1.1 Organizational Structure of the Department of Business, ... Assets, June 30, 20 02 42 Statement of Activities, Year Ended June 30, 20 02 43 Balance Sheet - Governmental Funds, June 30, 20 02 44 Statement of Revenues, Expenditures, and Changes in ... postaudits of the transactions, accounts, programs, and performance of all departments, offices, and agencies of the State of Hawaii (State) and its political subdivisions Background Section 26 -18 ,...
... loans written off as of June 30 FY2000- 01 FY1999 -20 00 94 96 10 6 45 49 53 48% 51% 50% $9,449,566 $9,9 71, 27 7 $ 12 ,10 7 ,29 2 $5,568,059 $5,9 31, 910 $6, 611 ,25 2 59% 59% 55% $2 81, 418 $734,966 $6, 824 To assist ... totaled $22 6 ,17 1, and the average number ofbusiness days elapsed between their receipt and deposit was six business days Checks amounting to $83, 325 and $29 ,500 were deposited six and nine business ... Scope and Methodology We audited the financial records and transactions and reviewed the related systems of accounting and internal controls of the department for the fiscal year July 1, 20 01 to...
... Comptroller General of the United States; and OMB Circular A -13 3, Audits of States, Local Governments, and NonProfit Organizations Those standards and OMB Circular A -13 3 require that we plan and perform ... CIRCULAR A -13 3 To the Auditor Office of the Auditor State of Hawaii: Compliance We have audited the compliance of the Department of Business, Economic Development and Tourism State of Hawaii (DBEDT) ... March 15 , 2 010 This is trial version www.adultpdf.com 52 PART IV SCHEDULE OF FINDINGS AND QUESTIONED COSTS This is trial version www.adultpdf.com 53 Department of Business, Economic Development and...
... Analysis and Applications, vol 27 3, no 1, pp 11 2 12 0, 20 02 [11 ] D W Boyd and J S W Wong, “On nonlinear contractions,” Proceedings of the American Mathematical Society, vol 20 , no 2, pp 458–464, 19 69 ... 459–465, 19 62 [15 ] G Jungck, Fixed point theorems for semi-groups of self maps of semi-metric spaces,” International Journal of Mathematics and Mathematical Sciences, vol 21 , no 1, pp 12 5 13 2, 19 98 ... 2b + 4c + 5e + 3g ≤ In Theorem 2. 2, set s = b + e + g, μ ≡ − (a + 2c + g), γ00 ≡ a, γ 01 = 10 ≡ c, γ 21 ≡ g, and γi j ≡ 0, otherwise Then (C) implies (2. 2) In Theorem 2. 3, set s = b + e + g, and...
... electronic journal of combinatorics 15 (20 08), #R68 3 X X X 0 Figure 5: The partial Latin square equivalent {000, 011 , 022 , 10 1, 11 0, 13 3, 20 2, 21 3 , 2 21 , 23 0, 303, 320 , 3 32} to the code Figure ... permutation R ( 12 ) C ( 12 ) S ( 12 ) squares with row of 032X and 023 X are equivalent to squares with row of 013 X and 031X Thus only squares with row of 0 12 X, 021 X, 013 X, or 031X are considered (figure 16 ) • ... 1, 2) = 16 We completely catalogue (3, V, 2) 4 codes where V = 8, 9, 10 , 11 , 13 , 14 , 15 , 16 and provide some examples for V = 12 Theorem 12 [6, Thm 3 .14 ] There is a unique (3, 8, 2) 4 code Proof...
... et al Journal of Experimental & Clinical Cancer Research 2 011 , 30 :16 http://www.jeccr.com/content/30 /1/ 16 Received: 30 September 2 010 Accepted: February 2 011 Published: February 2 011 References ... (Table 2) Restage before RIT: CT, PET, BMB Zevalin® FCR -28 CYCLES 11 .1- 14.8 MBq/Kg CR/CRu or PR F: 25 mg/m2 i.v days 1- 3 C: 1gr/m2 i.v day R: 375mg/m2 i.v day Figure Treatment schema Restage 12 weeks ... cycles of FCR: fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 375 mg/m2 was given on day of each cycle every 28 ...
... http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E coli and insect cells AmCPV S1 and S3 were expressed in E coli M15 cells as insoluble 14 1 kDa (Fig 2A, ... pH-7.3 (B), and at pH - 12 (C) and analyzed by TEM at 50 kV Bar 10 0 nm Chakrabarti et al Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Table Stability of native ... Chakrabarti et al Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Figure Immunoblot analysis of recombinant VLPs using anti-p137 and anti-p1 41 antibodies (A) SDS-8% PAGE,...
... 4, 12 11 Geneva 14 , Switzerland and 2Department of Pathology and Immunology, Geneva University Hospital and School of Medicine, rue Michel Servet 1, 12 11 Geneva 14 , Switzerland 19 Received: 10 ... transfection and reporter gene assays COL1A1 Hs0 016 4099_m1 TIMP -1 Hs0 017 1558_m1 MMP -1 Hs0 023 3958_m1 MMP -2 Hs0 023 4 422 _m1 HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT DNA pull-down assay Biotin-MMP -1- S GATCGAGAGGATGTTATAAAGCATG ... 19 Received: 10 December 20 09 Revised: April 2 010 Accepted: 29 April 2 010 Published: 29 April 2 010 21 20 ArthritisGoffin et al.;Therapy 2 010 , 12 :R73 under the terms of the Creative Commons Attribution...
... blackwell-synergy.com/links/doi /10 .11 11/ 14 71 8847.00007/abs/) Paul, R J and Townsend, J B (19 97) AIDS in the workplace: Balancing employer and employee rights Review of Business, 18 (2) , 14 Sedgwick, E K (19 90) Epistemology of ... Organizations, and Society, 15 , 28 Arya, A., Glover, J C., and Sunder, S (20 03) Are unmanaged earnings always better for shareholders? Ac counting Horizons 17 (supplem.): 11 1 16 Baxter, J and Chua, W F (20 03) ... Journal of Accounting and Public Policy, 13 : 79 94 Miller, P and O’Leary, T (19 87) Accounting and the construction of the governable person Accounting, Or ganizations, and Society, 12 (3), 23 5 65...