fixed current control at 120 rpm with alternate decay
AN1307 stepper motor control with dsPIC® DSCs
Ngày tải lên :
11/01/2016, 16:55
... Description FIXED_ DECAY Only one decay mode is used: baseDecay ALTERNATE_ DECAY Alternates between two decay modes: baseDecay and alternateDecay COMPARISON BETWEEN FIXED AND ALTERNATE DECAY 2009 ... earlier, in Fixed Decay mode there is only one decay mode used during motor operation The recommended decay mode is slow decay in the low MOSFET recirculation configuration Alternate Decay With all ... decay modes in this configuration • Alternating Decay: The controller uses two selected decay modes and switches between them at the appropriate time Fast Decay In Fast Decay mode, when the current...
- 26
- 256
- 0
Hysteresis Voltage Control of DVR Based on Unipolar PWM 95 With comparison of the obtained results docx
Ngày tải lên :
09/08/2014, 16:21
... triangular pulse-train with modulating duty cycle and frequency Modeling & Simulation of Hysteresis Current Controlled Inverters Using MATLAB 99 2.2 Error current mathematical description The ... overloads Limitation Voltage stability Limitation Voltage limitation Power generated Limitation Reactive power generated Limitation Load Power Limitation Based on market demands, ATC is computed ... Applications of MATLAB in Science and Engineering 3.2 Simulation results The StatCom model and the segmented PI controller with the values obtained from the previous section were simulated in Matlab/Simulink,...
- 53
- 434
- 0
LIFE AT PUGET SOUND WITH SKET CHE S OF TRAVE L IN WASHINGTON TERRITORY, BRITISH COLUMBIA, OREGON, AND CALIFORNIA 1865–1881 ppt
Ngày tải lên :
22/03/2014, 22:20
... curiosity to know what they were in search of, and listened with great interest when they attempted to talk with them The first group that Father Joseph gathered about him sat all night to hear ... hardly repress a smile at seeing that he spoke with the same enthusiasm of their success with the beans and potatoes, as with the ladder The truth is, that he had deeply at heart the good of these, ... minutes, without daring to look at each other with the consciousness that we were saved We presently saw that there were two little schooners beating up against the wind, directly towards us, and that...
- 158
- 313
- 0
Báo cáo khoa học: Sin3 is involved in cell size control at Start in Saccharomyces cerevisiae Octavian Stephan and Christian Koch ppt
Ngày tải lên :
23/03/2014, 05:22
... from BIOCAT (Heidelberg, Germany) b Strain was created by crossing strain CY5538 with CY5713 previously [58] Double mutants were created by mating After incubation on sporulation media plates for ... TE buffer to 30 lL of the supernatant and incubated for 16 h at 65 °C The eluates were treated with 0.5 lgÆlL)1 proteinase K for h at 37 °C Thereafter, coprecipitated DNA was purified by phenol ... the amplification of fragments from the coding regions were: CLN2, CK1724 (ATAGTGATGCCACTGTAGAC) and CK1725 (CATGATGGGGTTGATATGGT); CLN1, CK2254 (TAGTTCACCGCAAAGTACTG) and CK2255 (TATTGTAGAGGCCAGTTGCA);...
- 15
- 406
- 0
process control a first course with matlab cambridge series in chemical engineering
Ngày tải lên :
01/04/2014, 10:57
... 9.2.3 Servo systems with integral control 9.3 State Estimation Design 9.3.1 State estimator 9.3.2 Full-order state estimator system 9.3.3 Estimator design 9.3.4 Reduced-order estimator Review Problems ... (model) equations What are some of the mathematical tools that we use? In classical control, our analysis is based on linear ordinary differential equations with constant coefficients—what is called ... a) (s + b) s (s + a) (s + b) f(t) e at t e at t n – 1e – at (n – 1)! (1 – e – at) a (e – at – e – bt) b–a (1 – at) e – at (be – bt – ae – at) b–a 1 + (be – at – ae – bt) ab a–b P.C Chau © 2001...
- 255
- 2.8K
- 0
filtering control and fault detection with randomly occurring incomplete information
Ngày tải lên :
24/04/2014, 15:12
... problem is investigated with both sensor and actuator saturations www.it-ebooks.info Variance-Constrained Finite-Horizon Filtering and Control with Saturations 2.4.1 23 Problem Formulation Consider ... feedback controller of the form (2.47) such that, for the given disturbance attenuation level γ > 0, the positivedefinite matrix S and the initial state x(0), the saturated output ys (k) satisfies ... and Control with Saturations 35 0.5 x2 0.4 the estimation of x2 State x and its estimate 0.3 0.2 0.1 −0.1 −0.2 −0.3 −0.4 −0.5 10 12 Time (k) 14 16 18 20 Figure 2.5 The state x2 and its estimate...
- 269
- 227
- 0
Báo cáo hóa học: "Case-Control study of Firefighters with documented positive tuberculin skin test results using Quantiferon-TB testing in comparison with Firefighters with negative tuberculin skin test results" potx
Ngày tải lên :
20/06/2014, 00:20
... The realization that 31 of 35 cases with previous TBST positive response subsequently tested negative lends argument that a fair number of the cases may not be infected with TB All that can be ... Stata version 9.1 (StataCorp, College Station, TX) by a trained statistician from the University of Arizona In order to assess the QFT as an alternative diagnostic screening tool in this occupational ... in compiled format from the laboratory to the Principal Investigator Subjects and controls were provided with their individual test results In addition, the principle investigator, obtained the...
- 7
- 360
- 0
Báo cáo hóa học: " Research Article The Best Lower Bound Depended on Two Fixed Variables for Jensen’s Inequality with Ordered Variables" pot
Ngày tải lên :
21/06/2014, 07:20
... Rk , without loss of and Qi Using the notations ak x2 and Rk p, where generality, assume that x ≥ and p > 0, the inequality is equivalent to g x ≥ 0, where g x px2 − p x2p/ − P x − 2, p 5.2 with ... Inequalities and Applications References D S Mitrinovi´ , J E Peˇ ari´ , and A M Fink, Classical and New Inequalities in Analysis, vol 61 of c c c Mathematics and Its Applications, Kluwer Academic ... and Applications with equality for ··· a2 a1 In the case i , an−i ··· an−i an , 2.27 an−i an−i ··· 1, from 2.26 , we get a1 a2 · · · an ≥ √ n n a1 a2 · · · an a1 /an 2/n an /a1 , 2.28 with equality...
- 12
- 386
- 0
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" docx
Ngày tải lên :
22/06/2014, 19:20
... as that defined in [15] The base station has an omni-directional antenna with 120 beam width and is located in the center of the room The remote station has an omni-directional antenna with 60◦ ... the PSD 3.3 Nonlinear power amplification 3.2 Phase noise 3.3.1 Motivation 3.2.1 Motivation PN originates from nonideal clock oscillators, voltagecontrolled oscillators (VCO), and frequency synthesis ... Communications and Networking Indoor multipath @60 GHz-linear ZF receiver with precoder Indoor multipath @60 GHz-linear ZF receiver with precoder 10−1 Bit error rate () 100 10−1 Bit error rate ()...
- 14
- 350
- 0
Báo cáo hóa học: " Research Article Measurements of MIMO Indoor Channels at 1800 MHz with Multiple Indoor and Outdoor Base Stations" docx
Ngày tải lên :
22/06/2014, 22:20
... available spatial diversity in the capacity Several schemes with one or two base stations are also investigated, and the system improvement obtained when channel state information is available at the ... get a mobile station A battery allowed hours of stand alone power supply NI-PCI6071E, with a sampling rate of 40 ksps A dedicated PC is used to control the board and store the raw data Afterwards, ... each one was located at a different end of the fourth floor in the S3 building (maximal spatial separation) (iv) Case D: the transmitter antennas (D12, D34) were located at the at roof of the Q...
- 10
- 308
- 0
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" doc
Ngày tải lên :
22/06/2014, 22:20
... as that defined in [15] The base station has an omni-directional antenna with 120 beam width and is located in the center of the room The remote station has an omni-directional antenna with 60◦ ... the PSD 3.3 Nonlinear power amplification 3.2 Phase noise 3.3.1 Motivation 3.2.1 Motivation PN originates from nonideal clock oscillators, voltagecontrolled oscillators (VCO), and frequency synthesis ... Communications and Networking Indoor multipath @60 GHz-linear ZF receiver with precoder Indoor multipath @60 GHz-linear ZF receiver with precoder 10−1 Bit error rate () 100 10−1 Bit error rate ()...
- 14
- 313
- 0
Báo cáo hóa học: " Rate Control for H.264 with Two-Step Quantization Parameter Determination but Single-Pass Encoding" ppt
Ngày tải lên :
22/06/2014, 23:20
... control without QP refinement (PRC w/o QP refinement), and the proposed rate control with QP refinement (PRC with QP refinement) We analyzed the performances of these three rate control schemes with ... increases with the predicted standard deviation, as is suggested by (2) 2.3 Coefficient bits estimation The rate-quantization model proposed in [21] is used to estimate the coefficient bits estimation: with ... End of the frame? Yes Update the frame-level rate control model Figure 2: A flowchart of the proposed rate control scheme significant at low bit rates We therefore try to control the dynamic range...
- 13
- 271
- 0
THE THIRTEENTH CENTURY.—THE MANOR AT ITS ZENITH, WITH SEEDS OF DECAY ALREADY VISIBLE.—WALTER OF HENLEY pdf
Ngày tải lên :
29/06/2014, 15:20
... ridged, and the water made to run, and so the ground may be freed from water Here is his estimate of the cost of wheat growing[83]: 'You know surely that an acre sown with wheat takes threeploughings, ... their lands for money or work them themselves with hired labour Before that visitation, however, it appears that commutation of labour services for fixed annual payments had made very little progress.[71] ... at all We must not forget that the grazing of the tillage fields after the crops were off was of great assistance to those who kept stock; for there was plenty to eat on the stubbles The wheat...
- 19
- 291
- 0
WAVE OVERTOPPING AT SEA DIKES WITH CROWNN WALLS IN THE NORTHERN COASTAL DELTA OF VIETNAM
Ngày tải lên :
25/07/2014, 17:34
... experimental data Generally speaking, COBRAS-UC appears to reliably estimate overtopping rates at low crown-walls of various configurations (R2 = 0.95) The mean error is 23.4% with a standard deviation ... foundation for this thesis that is to investigate “Wave Overtopping at sea dikes with crown-walls in the northern coastal delta of Vietnam” Research objectives The thesis aims to investigate the ... out a literature study on wave overtopping at sea dikes with low crown-walls to select an approach that is inherent and also creative, suitable for Viet Nam 5.2 Study approaches Literature review;...
- 27
- 409
- 0
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc
Ngày tải lên :
08/08/2014, 01:21
... of the peat In relation with climatic change and increasing temperatures [22], it is not excluded that increasing summer temperatures will enhance pine evapotranspiration and accelerate further ... 200–213 [31] Matthey Y., Jacot-Descombes P., Les mesures de régénération et de cicatrisation des hauts-marais neuchâtelois, Premiers résultats et perspectives, Bull Soc Neuchatel Sci Nat 119 (1996) ... cluster already at a higher fusion level, whereas trees in the wetter part of the transect tend to cluster at a lower one, indicating that they grow with a more diverse radial growth pattern DISCUSSION...
- 10
- 277
- 0
Báo cáo y học: "Analysis of Fcγ receptor haplotypes in rheumatoid arthritis: FCGR3A remains a major susceptibility gene at this locus, with an additional contribution from FCGR3B" ppsx
Ngày tải lên :
09/08/2014, 07:20
... dGGCAGATTCCTCAGCAAATCA 56 FCGR2B (3'UTR) IIB-UTRSF dTGGGGAGGACAGGGAGAT IIB-UTRSR dATCACTTTTAATGTGCTGGTAGAGG 63 PCR1 dGGAGAAACCATCATGCTGAG 4INM dCAATTTTGCTGCTATGGGC 52 IIA-R dAATCCCAGAAATTCTCCCG ... Association with disease was tested for by comparing the haplotype frequencies estimated from cases and controls separately with estimates based on the combined sample, using a likelihood ratio ... strengthened our original observation that the FCGR genetic locus is associated with RA, particularly in a UK Caucasian population with nodular disease Our haplotype data, together with the stepwise regression...
- 9
- 450
- 0
Báo cáo y học: " A 1-year case-control study in patients with rheumatoid arthritis indicates prevention of loss of bone mineral density in both responders and nonresponders to infliximab" docx
Ngày tải lên :
09/08/2014, 10:20
... select a population of RA patients followed at the same institution at a time before the advent of anti-TNF-α treatment We first verified that our populations at baseline were representative We were ... (g/cm2) Patients with neck osteopenia (n [%]) Patients with lumbar osteopenia (n [%]) 93 (49) 40 (45) 53 (54) NS Patients with neck osteoporosis (n [%]) 37 (20) 18 (20) 19 (19) NS Patients with lumbar ... serum bone alkaline phosphatase, a marker of bone formation, was observed In patients with spondylarthropathy treated with infliximab, an early decrease in CTX-I was observed at months (-50%; P =...
- 7
- 498
- 0
báo cáo khoa học: " Control of mandibular incisors with the combined Herbst and completely customized lingual appliance - a pilot study" ppsx
Ngày tải lên :
11/08/2014, 20:20
... planned and achieved incisor rotations (setup-end) Negative values represent a counter-clockwise rotation (reclination), positive values, a clockwise rotation (proclination) of the mandibular incisor ... the literature that anchorage loss in the form of mandibular incisor CW rotation/proclination during Herbst treatment is a reality and cannot be prevented by any anchorage system combined with the ... evaluation studies is that only models were used for analysis, instead of lateral head films Lateral head films would clearly be able to show mandibular incisor inclination before and after treatment,...
- 4
- 416
- 0
Seeing Inside your Target at Run-Time with µC_Probe_LabProcedures
Ngày tải lên :
22/06/2015, 14:19
... indicates the order in which tasks were created The largest number indicates the first task created In this case, ‘13’ is the item number for the ‘Idle Task’ 2) The ‘Priority’ indicates the relative ... waveform is played back at a slower rate because µC/Probe doesn’t sample the data from the target fast enough to play the data at live speed In this case, we are simulating 60 BPM but slowed ... slider to set the ‘Speed’ to 1200 0 This will allow the J-Link connection to communicate with the target as fast as it can 4) Browse to the path where the J-Link DLL is located For convenience, we...
- 30
- 144
- 0
Intelligent control of robots interacting with unknown environments
Ngày tải lên :
08/09/2015, 18:23
... much attention of control researchers 1.2 Impedance Control Design Impedance Model Inverse + Kinematics - Position Control Robot Arm Fig 1.1: Position-based impedance control In the regard that ... to the interactive control mode, in which the estimated motion intention is integrated The above illustration indicates that there is an inherent delay from the intention estimation to the beginning ... Organization we employ impedance control and develop force regulation control to achieve humanrobot collaboration, subject to uncertain human limb dynamics Adaptive control is proposed to deal with...
- 196
- 462
- 0