first choose a key word that is central to the assignment for example if writing a paper about the value of education choose the word quot expectations quot and write that word in the middle of the paper circle it
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... the flap subdomain and the active site is analogous to the third metal, Mn2+, found in MtSTP [9] In order to bind the metal ion, the flap domain moves away from the core and the main chain conformation, ... flap domain in HsSTP might lead to binding of a third metal ion The implications of the M3 binding and flap subdomain conformations to the catalytic mechanism are discussed below The role of the third ... complex Although it is possible that the serendipitous interaction is only an artifact, it is apparently strong enough to appear in the crystal and adjust the enzyme in an induced-fit-like manner: the...
- 10
- 542
- 0
Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx
... of calendar year The Affordable Care Act comprises the Patient Protection and Affordable Care Act (P.L 111-148) and the health care provisions of the Health Care and Education Reconciliation Act ... EFFECTS OF REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 expects—with the economy projected to contract at an annual rate of 1.3 percent in the first half of the year and expand at ... out capital investment and the response of labor supply to changes in marginal tax rates—equal the midpoints of the ranges used by CBO Allowing for the full ranges that CBO uses for those parameters...
- 10
- 538
- 0
Semantics Semantics is the study of meaning that is used to understand human expression through language.
... us to classify the meaning of a word They are usually represented with a headword and using the symbols ‘+’ and ‘-’ to say if the word contains that feature There is no list of semantic features ... action In this case a ball Agent & theme The boy cut his hair with the scissors In this example, we can notice that there is a tool that helps the Agent to perform the action That is the semantic ... that a small elephant” for example, is much bigger than a big mouse” a Implicitly gradable pairs Another characteristic of certain pairs of gradable antonyms is that one is marked and the other...
- 26
- 954
- 2
Báo cáo y học: "Attributable cost of methicillin resistance: an issue that is difficult to evaluate" pps
... Critical Care Vol 10 No Timsit evidence of the cost of MRSA infections and provide new arguments for funding the fight against MRSA spread in the ICU Competing interests The author declares that ... ventilator-associated pneumonia Crit Care 2006, 10:R97 Safdar N, Dezfulian C, Collard HR, Saint S: Clinical and economic consequences of ventilator-associated pneumonia: a systematic review Crit Care ... Gonzalez J, Artigas A, Rodriguez-Roisin R: Ventilator-associated pneumonia by Staphylococcus aureus Comparison of methicillin-resistant and methicillin-sensitive episodes Am J Respir Crit Care...
- 2
- 170
- 0
Báo cáo khoa học: "SOFA is superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort study" doc
... the SOFA score, one Visual Basic program determined the most abnormal value for each parameter The program then calculated the appropriate SOFA value (range 0–4), which was then exported to a ... cardiovascular failure is a poor discriminator of outcome rather than SOFA overcalling cardiovascular failure due to vasopressor use for cerebrovascular support In general, an increasing SOFA respiratory ... SOFA-defined cardiovascular failure, and patients without SOFA-defined or MOD-defined cardiovascular failure This categorization was tabulated in association with hospital mortality, which was...
- 10
- 388
- 0
Tài liệu The Culture That Gave Rise To The Current Financial Crisis pptx
... and, in the financial arena, bestowal of wealth to traders and managers that is totally disproportionate to the value they add to investors’ wealth Indeed, the financial sector actually subtracts ... America, was a pathological mutation in capitalism—from traditional owners’ capitalism, in which the rewards of investing went primarily to those who put up the capital and took the risks, to a new ... freedom that was uppermost in Hamilton’s mind, spurring individual initiative, but also gathering the fruits of that energy in the cause of national greatness Were Alexander Hamilton alive today,...
- 16
- 357
- 0
Tài liệu Báo cáo khoa học: The PA-TM-RING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis ppt
... sorting the bean storage protein phaseolin to the protein storage vacuole [13] and was shown to bind to C-terminal vacuolar sorting determinants on tobacco chitinase and barley lectin [14], establishing ... contains a PA domain Binding of vacuolar proteases requires the PA domain as well as other regions of the BP-80 luminal domain [7] RING finger proteins constitute a subfamily of the proteins that ... the characteristic polyubiquitin ladder This indicates that catalysis of polyubiquitin chains is specific to the RING-H2 domain of purified RNF13, as a single point mutant of a conserved cysteine...
- 18
- 483
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
... annealing the following primers: 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ ... Chishti AH, Anderson JM & Walther Z (2000) hCASK and hDlg associate in epithelia, and their src homology and guanylate kinase domains participate in both intramolecular and intermolecular interactions ... retinal cDNA library Alignments of the MPP3 cDNA with the human genome database indicated that the open reading frame was split into 18 exons Sequence analysis of the cDNA products revealed that there...
- 14
- 449
- 0
how the use of the diary form narrative is beneficial to the
... combination of descriptions, facts, that represents a group as a whole and the reader can feel as if they are part of the group and read, and think along with the characters Another thing dealing with the ... through a person that isn't being a fool talking to him or her self The diary form of narrative is basically a form of writing that lets a huge possibility of good ways to write into a good book ... happen when the diary form of narrative is used For instance, after Lucy had written what was happening to her when her mother passed away, the story went back in time for another important matter...
- 2
- 473
- 0
Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc
... text-generation methods for producing health-information and patient -education material that is tailored to the personal and medical characteristics of the individual patient receiving it Information ... to later Fortunately, in such clinical situations, much of the information that is needed for tailoring health -education material is available in the patient’s medical record Indeed, a medical ... project: the kinds of tailoring that are appropriate for health -education documents; the nature of a tailorable master document, and how it can be created; and the linguistic problems that arise when...
- 12
- 379
- 0
GRAPHIC DESIGNERS ARE CENTRAL TO THE PROCESS pdf
... HEAL ME Print and paper advocates in business and industry are analyzing the data, marshalling the facts, building their case, providing their proofs In the face of the online wave, they are making ... whether “sustainability” as a design factor is on the increase or decrease among projects and assignments Here, 56% said sustainability is a growing factor and more than 41% say it has remained ... THE QUALITY, CHARACTER, BRAND OF PAPER STILL MATTER? Often we design to the qualities of the paper The paper available is considered, even in brainstorming It is an important factor and must be...
- 15
- 279
- 0
Báo cáo hóa học: " Vaccinia virus lacking the deoxyuridine triphosphatase gene (F2L) replicates well in vitro and in vivo, but is hypersensitive to the antiviral drug " pot
... or the spontaneous deamination of cytosine and can result in A: T transition mutations in one of the nascent strands [1] Minimizing the incorporation of these bases and excising those that arise ... dUTPase as a target for antiviral therapy, F2L was deleted in the WR strain of VV and the replication of the mutant virus (VV Δ F2L-gfp) was evaluated in cell culture and in intranasally infected ... contributed to the conception of the studies and the critical review of the manuscript DCQ contributed to the design of the experiments and analysis of the data KAK contributed to the acquisition and interpretation...
- 6
- 330
- 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... vaccines and therapeutics will be greatly aided by gaining a better understanding of the local mechanisms of immunity Conclusion These data demonstrate, first, that the functional impairment of ... tetramer/pentamer+CD8+ and IFNγ+CD8+ cells from the lungs and Examples of primary data of flow cytometry analysis of tetramer/pentamer+CD8+ and IFNγ+CD8+ cells from the lungs and the spleens of individual ... was administered either by the IN or ID route IN inoculation of mice with the WR strain of VV has been shown to cause respiratory tract infection followed by dissemination of the virus to various...
- 8
- 381
- 0
Báo cáo y học: "Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22-620W allele" docx
... TDT RA sample and a global analysis for all TDT RA families We also investigated the PTPN22 putative genotype in the index ASP RA sample, taking advantage of the linkage data available at the ... an amino acid substitution of arginine for tryptophan at position 620 (R620W), in the P1 proline-rich domain This domain is involved in the binding to the SH3 domain of Csk Functional analysis ... and FC performed acquisition of the data PD, SG, LM, CP, BP and FC analyzed and interpreted the data LM, SL and TB made a substantial contribution to the acquisition of clinical data and the follow-up...
- 8
- 342
- 0
Báo cáo y học: "Cis-regulation of IRF5 expression is unable to fully account for systemic lupus erythematosus association: analysis of multiple experiments with lymphoblastoid cell lines" doc
... design of the study and the acquisition of data and supervised the genotyping, statistical analysis, interpretation of results and the writing of the manuscript All authors read and approved the final ... microarray data and participated in the interpretation of the results and the writing of the manuscript JJGR participated in the analysis and interpretation of the results AG participated in the ... S and C, permitted us to obtain a global average that was denoted KSC For an analysis of the unselected data, see Additional file 2, Supplementary Information To increase the generality of the...
- 12
- 355
- 0
Some Issues of E-pedagogy A Case Study at University of Education (VNU-UED)
... usability E-learning usability characteristic is the idea that interactive applications should be easy to use and easy to learn, and in order to this, developers have to take into consideration ... pedagogy for e-learning format with existing learning activities nowadays In this way, the issue of integrating e-pedagogy into the pedagogical system has recently emerged as an important and pressing ... roles of both teacher and learner The critics of traditional LT or approaches to teaching and learning make two arguments: they are not working in new context; or /and they misunderstand the nature...
- 12
- 340
- 0
Retrovirology Research BioMed Central Open Access A novel HIV-1 restriction factor that is potx
... A3 B, A3 DE, A3 F, and A3 G contain two Zinc-binding motifs, while A3 A, A3 C, and A3 H contain only one A3 B, A3 DE, A3 F, and A3 G inhibit HIV-1 replication to different degrees, whereas A3 A and A3 C not ... binds to and mediates the destruction of A3 DE, A3 F, and A3 G in 26S proteasomes via recruitment of the Cullin5 ubiquitin E3 ligase [23,24] Vif may also inhibit A3 activity independent of proteasomal ... were infected and treated similarly After that, cellular DNAs were extracted and HIV genes were amplified by PCR and cloned into a T -A cloning vector for sequencing It was found that all viral...
- 12
- 279
- 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...
- 11
- 501
- 0
To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf
... and higher loan -to- value ratios Reason To increase the risksensitivity of capital requirements in a scenario of rapid growth in credit to these sectors To increase the risksensitivity of capital ... Rica, Dominican Republic, Guatemala, and Paraguay, still have a See Marques and Manrique (2004) for Germany and the United States, Andres et al (2009) for the United States and the Euro area, Basdevant ... increase availability of international liquidity for local banks.These measures are also intended to avoid short term capital inflows and liquidity to translate into an unsustainable expansion of credit...
- 48
- 504
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25