first a bit of background

Flashcard blueup – A bit of English on your journey!

Flashcard blueup – A bit of English on your journey!

Ngày tải lên : 02/10/2012, 12:02
... nhanh chóng có mặt thời gian tới Giới thiệu blueup IELTS Bộ sản phẩm flashcard blueup IELTS bao gồm 1100 từ vựng, chia thành 11 khác thuộc từ “Cambridge Vocabulary for IELTS” Pauline Cullen B a ... Cullen B a IELTS B a IELTS2 blueup hy vọng với blueup IELTS giúp bạn tạo tảng vững trước tham gia kỳ thi IELST blueup triển khai IELTS IELTS Mua flashcard blueup nào? Sản phẩm flashcard blueup thị ... TOEIC” Trong giai đoạn tháng 10 tháng 11 năm nay, blueup khởi động TOEIC B a TOEIC B a TOEIC2 Giới thiệu blueup TOEFL Bộ sản phẩm flashcard blueup TOEFL iBT bao gồm 1500 từ vựng, chia thành 15 khác...
  • 10
  • 1.5K
  • 3
The Sweet Season A SPORTSWRITER REDISCOVERS FOOTBALL, FAMILY, AND A BIT OF FAITH AT MINNESOTA’S ST. JOHN’S UNIVERSITY pot

The Sweet Season A SPORTSWRITER REDISCOVERS FOOTBALL, FAMILY, AND A BIT OF FAITH AT MINNESOTA’S ST. JOHN’S UNIVERSITY pot

Ngày tải lên : 24/03/2014, 02:21
... captains—“They’re all great guys, and this way they can all put ‘Captain’ on their resumé,” he says Their calisthenics, a parody of a typical team’s cals, include such exercises as Mary Catharine ... hundredgo! All thatdetails—was to have a trailer mere innesota was a remained—after tying up a two logistical hitch affixed to the family station wagon, rent a U-Haul, and hit the trail! If you need a ... had grown weary of serial gridiron thrashings at the hands of Concordia, St Olaf’s, and Gustavus Adolphus Gagliardi was hired, and college football hasn’t been the same since All his seniors are...
  • 337
  • 475
  • 0
107   a bit of fry and laurie language conversation

107 a bit of fry and laurie language conversation

Ngày tải lên : 25/08/2016, 14:42
... That surely is a thought to take out for a cream tea on a rainy Sunday afternoon Hugh looks at camera, opens mouth as if to speak, decides against it Speaks to Stephen instead Hugh So to you language ... harmonies are being composed upon hundreds of keyboards every day in Dorset alone Our language, Tiger, our language, hundreds of thousands of available words, frillions of legitimate new ideas, ... from an old bookshelf a forgotten volume of erotic diaries; language is the faint scent of urine on a pair of boxer shorts, it's a halfremembered childhood birthday party, a creak on the stair, a...
  • 4
  • 354
  • 0
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Ngày tải lên : 07/11/2012, 15:01
... respectful attitudes of Paley and Alvarez towards the value of life are always appreciated, especially in the contemporary age of technology, diseases and social evils, which has caused escalating ... about racial discrimination in America, about Rosa Parks, a black woman who was arrested for her refusal of the bus driver’s order to give up her seat to a white rider in Mongomery, Alabama and about ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...
  • 49
  • 785
  • 1
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

Ngày tải lên : 29/01/2014, 10:33
... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively ... may be described as holistic or “conceptually driven” (Brown) in that they focus on the overall meaning of a passage, and the application of schemata Schemata are mental frameworks based on past ... have a great tendency to attract the attention of students that other forms of the mass media lack According to Subramaniyan A Nambiar (1985), “ Even the person who is totally tone deaf may at...
  • 39
  • 1.1K
  • 3
Tài liệu A Collection of State-Papers, Relative to the First Acknowledgment doc

Tài liệu A Collection of State-Papers, Relative to the First Acknowledgment doc

Ngày tải lên : 20/02/2014, 08:20
... people ancient or modern The consequences of these establishments we see and feel every day. A native of America who cannot read and write, is as rare an appearance as a Jacobite, or a Roman Catholic, ... productions of America, the materials of manufactures, navigation and commerce; the vast demand and consumption in America of the manufactures of Europe, of merchandises from the Baltic, and from the East ... consequence of the taxes and imposts which the inhabitants of this State pay in a greater number, and a higher rate, than in any other country, by reason of her natural situation, and of its means to...
  • 49
  • 552
  • 0
The Credit Crunch of 2007-2008: A Discussion of the Background, Market Reactions, and Policy Responses potx

The Credit Crunch of 2007-2008: A Discussion of the Background, Market Reactions, and Policy Responses potx

Ngày tải lên : 15/03/2014, 07:20
... for at fair values, and while it has the advantage of presenting current valuations on assets and liabilities of banks rather than historic cost valuations, it also has some negative implications ... Reform Act of 2008 provides a regulator for GSEs and the Federal Home Loan Banks—will offset these dangers The regulator will be able to establish capital standards, prudential management standards, ... the capital to be held against assets? This is a question of accounting as much as regulation Since 1998 the Financial Accounting Standards Board (FASB) in the U.S Statement of Financial Accounting...
  • 38
  • 492
  • 0
A Compilation of the Messages and Papers of the Presidents Section 3 (of 3) of Volume 8: Grover Cleveland, First Term. pptx

A Compilation of the Messages and Papers of the Presidents Section 3 (of 3) of Volume 8: Grover Cleveland, First Term. pptx

Ngày tải lên : 31/03/2014, 11:20
... North and Central America, the West India Islands, the Bahamas and Bermudas, Mexico, and the Isthmus as far as Aspinwall and Panama The Governments of Belgium, Denmark, Germany, Portugal, and Sweden ... CLEVELAND A Compilation of the Messages and Papers of the Presidents PROCLAMATIONS BY THE PRESIDENT OF THE UNITED STATES OF AMERICA A PROCLAMATION Whereas it is alleged that certain individuals, associations ... service at missions which for any cause may be without a head, should also be authorized I favor also authorization for the detail of officers of the regular service as military or naval attachés at...
  • 477
  • 487
  • 0
báo cáo hóa học:" Discontinuation of standard first-line antiretroviral therapy in a cohort of 1434 Malawian children" ppt

báo cáo hóa học:" Discontinuation of standard first-line antiretroviral therapy in a cohort of 1434 Malawian children" ppt

Ngày tải lên : 20/06/2014, 08:20
... tenofovir and lopinavir/ritonavir, while the paediatric second-line regimen is abacavir, didanosine and lopinavir/ritonavir The Malawi Ministry of Health is investigating a potential change of ... similar studies in paediatric populations are lacking [6,7] An analysis of retrospectively collected cohort data was undertaken to assess the reasons for discontinuation of standard first- line ART ... http://www.jiasociety.org/content/13/1/31 Page of Table Reasons for discontinuation of standard first- line ART regimen Reason for discontinuation of standard first- line ART (d4T/3TC/NVP) Number of patients (male/female) a Toxicity...
  • 4
  • 300
  • 0
báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf

báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf

Ngày tải lên : 21/06/2014, 00:20
... elliptic equations, diagonal systems and variational integrals Manuscripta Math 55, 467–486 (1986) doi:10.1007/BF01186659 Rutkauskas, S: On the first boundary value problem for the class of elliptic ... is that spherical coordinates are more convenient than Cartesian in the calculation of the m coefficients anm of series (25) The matter is such that spherical functions Yn (ϕ, ϑ) have quite a simple ... (Russian) Achildiyev, SA: First and second boundary value problems for elliptic equations degenerating at the inner points of finite number Dokl Akad Nauk SSSR 152(1), 13–16 (1963) (Russian) Yanushauskas,...
  • 11
  • 399
  • 0
Báo cáo hóa học: "Research Article A First Comparative Study of Oesophageal and Voice Prosthesis Speech Production" docx

Báo cáo hóa học: "Research Article A First Comparative Study of Oesophageal and Voice Prosthesis Speech Production" docx

Ngày tải lên : 21/06/2014, 20:20
... Nazionale, et al., “Evaluation of various phonatory parameters in laryngectomized patients: comparison of esophageal and tracheo-esophageal prosthesis phonation,” Acta Otorhinolaryngologica Italica, ... EURASIP Journal on Advances in Signal Processing Table 2: Average and standard deviation for patient data, vocal, and pressure parameters Personal data [Hz] [ms] [%] Tracheostoma pressure Acoustic ... better way to communicate and quality of the life Each patient’s voice signal (oesophageal EV and tracheoesophageal TEP) has been recorded and treated with the developed MATLAB program As an example,...
  • 6
  • 335
  • 0
Báo cáo y học: "A first genome assembly of the barley fungal pathogen Pyrenophora teres f. teres" ppt

Báo cáo y học: "A first genome assembly of the barley fungal pathogen Pyrenophora teres f. teres" ppt

Ngày tải lên : 09/08/2014, 22:23
... Australia Aust Plant Pathol 2010, 39:46-49 Tekauz A: Characterisation and distribution of pathogenic variation in Pyrenophora teres f teres and P teres f maculata from western Canada Can J Plant ... extensions and their codes Abbreviations ABC, ATP-binding cassette; AFLP, amplified fragment length polymorphism; BAC, bacterial artificial chromosome; bp, base pair; DDBJ, DNA Data Bank of Japan; EST, ... Ascochyta spp sequenced in-house, Ascochyta rabiei and Phoma medicaginis (Ramisah Mod Shah and Angela Williams, personal communication) was used to reveal P teres f teres-specific expansion of...
  • 14
  • 448
  • 0
Báo cáo y học: "First somatic mutation of E2F1 in a critical DNA binding residue discovered in well- differentiated papillary mesothelioma of the peritoneum" doc

Báo cáo y học: "First somatic mutation of E2F1 in a critical DNA binding residue discovered in well- differentiated papillary mesothelioma of the peritoneum" doc

Ngày tải lên : 09/08/2014, 23:20
... (5’-TGGCAAAGGAGCAGATTAGTAGG-3’) SIRT1-R (5’-TCATCCTCCATGGGTTCTTCT-3’) Cyclin E1-F (5’-GGTTAATGGAGGTGTGTGAAGTC-3’) Cyclin E1-R (5’-CCATCTGTCACATACGCAAACT-3’) APAF1-F (5’-TGACATTTCTCACGATGCTACC-3’) APAF1-R ... GCAGCCACAGTGGGTATTACT 3' E2F1_R: 5' GGGGAGAAGTCACGCTATGA 3' TRAF7_F 5’ GCCTTGCTCAGTGTCTTTGA 3’ TRAF7_R 5’ CATGTTGTCCATACTCCAGACC 3’ PPFIBP2_F: 5’ CCCTCGAGCCATTTGTATTT 3’ PPFIBP2_R: 5’ CCACAGCAGAAGCTGAAAGA ... ANOVA: analysis of variance; AP1: activator protein 1; APAF1: apoptotic peptidase activating factor 1; BAM:– binary version of Sequence Alignment/Map format; BAP1: BRCA1 associated protein-1; BWA:...
  • 40
  • 426
  • 0
Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc

Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc

Ngày tải lên : 11/08/2014, 16:22
... speak clearly and avoid clinical and technical language The first aider should communicate with the person as an equal, rather than as a superior expert The first aider should remember that behaviour ... Arlington VA: American Psychiatric Association; 2004 Australian Centre for Posttraumatic Mental Health: Australian Guidelines for the Treatment of Adults with Acute Stress Disorder and Posttraumatic ... independently of the parent or guardian, except in an emergency The first aider should be aware of the types of professional help which are available for children The first aider should be aware that the...
  • 15
  • 342
  • 0
Báo cáo y học: " The first case report of dental floss pick-related injury presenting with massive hemoptysis: A case report" ppsx

Báo cáo y học: " The first case report of dental floss pick-related injury presenting with massive hemoptysis: A case report" ppsx

Ngày tải lên : 11/08/2014, 23:21
... a sneezing episode The patient was a taxi driver and had no history of cigarette smoking, alcohol drinking, upper airway complaints, chest trauma, or use of aspirin or nonsteroidal anti-inflammatory ... for tracheobronchial foreign body removal with success rates of more than 90% - A dental floss pick may present as a tracheobronchial foreign body and can reside in the airway asymptomatically ... Archives of internal medicine 1968, 121(6):495-498 Tuncozgur B, Isik AF, Nacak I, Akar E, Elbeyli L: Dilemma on the treatment of haemoptysis: an analysis of 249 patients Acta chirurgica Belgica 2007,...
  • 5
  • 225
  • 0
first facts farm start a lifetime of learning

first facts farm start a lifetime of learning

Ngày tải lên : 27/10/2014, 14:15
... Turkeys are huge birds that make a strange gobbbling sound Other farm animals Some big farms raise only one type of animal But smaller farms often have lots of different creatures roaming around ... that keep ep fam e ily A male sheep is called a ram A female sheep is called a ewe, and a baby sheep is a lamb sh them nice and warm 12 coll In spring the sheep’s fur, the fleece, is shaved, ... The large, bag-like part of a cow that holds milk for her calves vehicle A machine with wheels and an engine that’s used to carry people or things Index alpaca 17 apple 26 baler 19 bread 24...
  • 30
  • 158
  • 0
a translation quality assessment of the first three chapters of the novel the da vinci code by do thu ha (2005) based on j.house's model = đánh giá chất lượng bản dịch ba chương đầu tiên trong cuốn tiểu thuyết

a translation quality assessment of the first three chapters of the novel the da vinci code by do thu ha (2005) based on j.house's model = đánh giá chất lượng bản dịch ba chương đầu tiên trong cuốn tiểu thuyết

Ngày tải lên : 02/03/2015, 14:22
... componential analysis, and case grammar) to the analysis of translations For translation evaluation, which he names as translation criticism, his distinction between semantic and communicative translation ... named semantic translation and communicative translation They are put in the form of a flattened V diagram as below: SL emphasis TL emphasis Word-for-word translation Adaptation Literal translation ... of data is document, and information is gathered by an analysis of documents and materials Data are categorized into patterns as the primary basis for organizing and reporting results Qualitative...
  • 83
  • 776
  • 4
A survey of factors that demotivate first-year non-major students in learning English at University of Labor and Social Affairs

A survey of factors that demotivate first-year non-major students in learning English at University of Labor and Social Affairs

Ngày tải lên : 19/03/2015, 10:28
... the amount of background information available and to see that they are able to use them Besides, language items such as vocabulary and grammatical structures can be considered to have an impact ... book and key At University of Labor and Social Affairs, teachers take charge of teaching Basic English Among them, have MA Degree and the rest hold a bachelor degree in English Language Teaching ... study, participants and setting of the study, data collection instruments, data collection procedure, and data analysis procedure Chapter presents data analysis and discussion This chapter analyses,...
  • 67
  • 752
  • 5