finding the first list element that passes a test
o'reilly - perl cookbook
... camelids are the familiar camel, his friends the llama and the alpaca, and the rather less well-known guanaco and vicu a FINIS Be warned: all the patterns in this recipe use \s, which will also match ... fundamental unit for working with data is the scalar, that is, single values stored in single (scalar) variables Scalar variables hold strings, numbers, and references Array and hash variables hold lists ... Temporary Variables 1.2 Establishing a Default Value Problem You would like to give a default value to a scalar variable, but only if it doesn't already have one It often happens that you want a hard-coded...
- 1,096
- 1,310
- 0
Báo cáo y học: " Autonomic Dysfunction Presenting as Postural Orthostatic Tachycardia Syndrome in Patients with Multiple Sclerosis"
... Demyelinating plaques may disrupt reflex pathways in the insular, cingulated and ventromedial prefrontal cortices, central nucleus of the amygdala, paraventricular hypothalamus and the medulla In addition ... in the study The mean age at the time of diagnosis was 49±9 years and of the patients were women All the patients were Caucasians All patients were being followed by a neurologist who specialized ... shown that both sympathetic as well as parasympathetic dysfunction can occur in patients with MS (12-16) Reduced heart rate variability and vasomotor dysfunction in MS appears to correlate with the...
- 6
- 478
- 0
Functions with multiple outputs
... performance; can use random pivot • Divide and conquer algorithm; easily parallelizeable • Recursive; in worst case, can cause stack overflow on large array 29 Searching a sorted array • Searching an ... Sorting Algorithms Linear Search A Simple Sort Faster Sorting Binary Search 18 Strings as arrays • Strings stored as null-terminated character arrays (last character == ’\0’) • Suppose char str ... Sorting Algorithms Linear Search A Simple Sort Faster Sorting Binary Search Pointers and addresses • Pointer: memory address of a variable • Address can be used to access/modify a variable from anywhere...
- 41
- 184
- 0
Tài liệu Adding Records with a GUID Primary Key pdf
... // Add the tables to the DataSet and create the relationship ds = new DataSet( ); ds.Tables.Add(parentTable); ds.Tables.Add(childTable); ds.Relations.Add(new DataRelation("Parent_Child_Relation", ... facilitate working with GUIDs The RowChanging event of the DataTable is raised when a DataRow is changing The action that occurred on the row can be determined by the Action property of the DataRowChangingEventArgs ... by handling the RowChanging event for each table When a row has been added, that is, the Action property of the DataRowChangingEventArgs argument is Add, the DefaultValue for the primary key column...
- 4
- 340
- 0
Tài liệu Báo cáo khoa học: "Learning to Translate with Multiple Objectives" doc
... Sa a Hasan, and Hermann Ney 2008 s Automatic evaluation measures for statistical machine translation system optimization In International Conference on Language Resources and Evaluation, Marrakech, ... passiveaggressive algorithms Journal of Machine Learning Research, Kalyanmoy Deb, Amrit Pratap, Sammer Agarwal, and T Meyarivan 2002 A fast and elitist multiobjective genetic algorithm: NSGA-II ... Machine Translation P Liang, A Bouchard-Cote, D Klein, and B Taskar 2006 An end-to-end discriminative approach to machine translation In ACL Ding Liu and Daniel Gildea 2007 Source-language features...
- 10
- 624
- 0
Tài liệu Báo cáo khoa học: "Extending the Entity-based Coherence Model with Multiple Ranks" pot
... experimented on two datasets: news articles on the topic of earthquakes (Earthquakes) and narratives on the topic of aviation accidents (Accidents) A training data instance is constructed as a pair consisting ... the training data is increased while no further manual annotation is required, which is favorable in real applications when available samples with manually annotated coherence scores are usually ... information about the document was encoded Their extended model significantly improved ranking accuracies on the same two datasets used by Barzilay and Lapata (2008) as well as on the Wall Street...
- 10
- 363
- 0
Báo cáo khoa học: "Discourse Processing of Dialogues with Multiple Threads" pot
... information in machine translation In (Iida and Arita 1990; Kogura et al 1990), researchers at ATR advocate an approach to machine translation called illocutionary act based translation, arguing that ... threads, as in the case of parallel suggestions negotiated at once We approach this problem by modeling Attentional State as a graph structured stack rather than as a simple stack A graph structured ... And any State-Constraint can attach to the active p a t h as a confirmation because the constraints on confirmation attachments are very weak Since State-Constraint is weaker than Accept, it...
- 8
- 266
- 0
Discovering Frequent Event Patterns with Multiple Granularities in Time Sequences docx
... include database theory, query languages and query optimization, databases with sequential data such as temporal and sequence, as well as multidimensional databases Dr Wang is a member of the ACM and ... from the root variable and k other variables in S , where these variables (including the root) form a subchain in S (i.e., they are all on a particular path from the root to a particular leaf), and ... matter what m and n are The reason is that [0, 0]GD\ is satisfied by any two events that happen during the same day, whether the day is a business day or a weekend day In our framework, we allow...
- 16
- 395
- 0
Báo cáo khoa học: "American Sign Language Generation: Multimodal NLG with Multiple Linguistic Channels" pot
... processing channels for text, maps, other graphics, and sound effects An ECA system may have separate channels for eye gaze, facial expression, manual gestures, and speech audio of the animated character ... to animate the head/body of the animated character, and the NLG system can be used to control only the hands of the character Thus, channels of the NLG system can be isolated for evaluation – an ... (Kopp et al., 2004) has similarities to this ASL project First of all, the channels in the signal are basically the same; an animated human-like character is shown onscreen with information about...
- 6
- 200
- 0
Báo cáo khoa học: "DEDUCTIVE PARSING WITH MULTIPLE LEVELS OF REPRESENTATION*" pptx
... the lexicon and rarameter values that constitute the specific knowledge of a human language beyond Universal Grammar as a set of formulae in that logical language In the theory of of Universal ... exactly the same theory of Universal Grammar Thus the original axiomatization U of Universal Grammar used in the PAD parsers can b e r e p l a c e d w i t h a n y e q u i v a l e n t axiomatization ... Interestingly, a data-flow analysis of this transformed axiomatization (viewed as a Prolog program) justifies a further transformation that yields an equivalent program that avoids the construction...
- 8
- 269
- 0
Assessment and Management of the Elderly Patient with Multiple Sclerosis pot
... essential The benzodiazepines are traditionally poorly tolerated in the older population and are associated with an increased half-life and a higher association of paradoxical reactions, agitation, ... opioid analgesics, nonsteroidal anti-inflammatory drugs (NSAIDS), antiseizure medication, antidepressants anti-spasticity agents, and cannabinoids An intrathecal pump may also be beneficial for pain ... stroke, gastrointestinal bleeding, and renal insufficiency.22 Carbemazapine and other anticonvulsants may also increase confusion and ataxia in the elderly Tricyclic antidepressants (TCAs) or other...
- 11
- 508
- 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
... ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT P3F P3R GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC ... GTACTATTGGATCCATGCTGACG P2 GTCCTGTAAGCTTAAGTCGTGTC P3 P4 P6 TTCCCGCATCTCACACGTCA CATATCTGCTATGGATGTAC GTCACACCTTTCGTCGCAGC P8 94RTf 94RTr 1994intR TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT ... GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment CmtR protein...
- 12
- 462
- 0
Báo cáo khoa học: "Joint Decoding with Multiple Translation Models" docx
... statistical machine translation In Proc of ACL08 David Chiang 2005 A hierarchical phrase-based model for statistical machine translation In Proc of ACL05 David Chiang 2007 Hierarchical phrase-based ... model can be structured as a translation hypergraph, which makes each model connectable to others (Section 3.1) Then, we show that a packed translation hypergraph that integrates the hypergraphs ... many derivations that are distinct yet produce the same translation Blunsom et al (2008) present a latent variable model that describes the relationship between translation and derivation clearly...
- 9
- 295
- 0
Imputation Methods to Deal with Missing Values when Data Mining Trauma Injury Data pot
... of a model under a particular imputation method is then the mean performance of the five validation data sets In many data mining efforts the evaluation criterion is the overall accuracy i.e the ... (complete-case) was performed The mean accuracy measures of the five validation datasets are given along with the betweenvalidation standard errors The performance of the complete-case analysis is ... different approaches to the statistical analysis of these data were carried out; data mining using an artificial neural network (ANN) and logistic regression modelling (LR) All analysis was carried out...
- 6
- 510
- 1
Báo cáo khoa học: "Text Segmentation with Multiple Surface Linguistic Cues" pptx
... t h a t form a semantic unit We use the information of the lexical chains and the gaps of lexical chains that are the parts of the chains with no words The gap of a lexical chain can be considered ... considering the case where the system selects boundary candidates at random In the case, the precision equals to the mean probability that each candidate will be a correct boundary The recall is equal ... determine the weights automatically, because it can avoid the need for expert hand tuning and can achieve performance that is at least locally optimal We use the training texts t h a t are tagged...
- 5
- 181
- 0
Báo cáo khoa học: "TEXT UNDERSTANDING WITH MULTIPLE KNOWLEDGE SOURCES: AN EXPERIMENT IN DISTRIBUTED PARSING" docx
... containing an alarm, causing in such a way a change in the priority of the semantic analysis problem, that will become Fatal The other three messages sent by the CM to RS, QS, and TS will have a ... same task (e.g., for syntactic analysis) As we have stated that specialists are independent problem solvers, we also assume that they have no mutual knowledge: they not know about each other, they ... message handling capability, has also its own strategies that can override, when needed, the basic message-driven style, thus affecting the overall operation of the parser These strategies, that...
- 5
- 217
- 0
channel adaptive technologies and cross layer designs for wireless systems with multiple antennas
... systems With the availability of perfect channel state information (channel matrix), power adaptation (in both the temporal and spatial domains) and rate adap- Adaptive channel encoder Adaptive power ... sufficiently separated so that they are spatially uncorrelated The advantage of having multiple antennas at the transmitter and the receiver is to transform the original wireless fading channels into multipleinput ... Gaussian MAC capacity region C Comparison between average packet delay and average arrival rate of various scheduling algorithms in a two-user MAC channel [145] Routing mechanisms in the RICA...
- 544
- 313
- 0
báo cáo hóa học: "The impact of regular physical activity on fatigue, depression and quality of life in persons with multiple sclerosis" pot
... eral assessment of fatigue Higher scores indicate that fatigue has a greater impact on the individual The MFIS has been suggested as a useful measure of fatigue in MS research and clinical practice ... concept and design, data collection and collation, data analysis, writing and editing of the manuscript CM was involved in the conception and design of the study, as well as data analysis and writing ... Queensland, Australia listed on the Multiple http://www.hqlo.com/content/7/1/68 Sclerosis Society of Queensland's patient database, and 118 MS patients listed on a database at the Gold Coast Hospital,...
- 10
- 683
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008