find the maximum value and return a pointer to it
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
Ngày tải lên :
19/02/2014, 12:20
... subjected to TSA treatment, we used a chromatin
immunoprecipitation assay (ChIP) and evaluated the
acetylation status of the so-called B- and nucleosome F [4]
and compared these patterns with the M13 ... 2004
genes. The studies have revealed that both histone acetyl-
transferases (HATs) and histone deacetylases (HDACs)
play a vital role in gene regulation by either allowing
transcription or establishing ... early
addition of TSA. In this case, the nucleosome B area is
distinctly hypersensitive to MNase action, especially at high
concentrations. Late addition of TSA, on the other hand,
had virtually...
- 10
- 500
- 0
Money and happiness a guide to living the good life
Ngày tải lên :
12/03/2014, 14:51
... a road map to wealth with practical financial tools
and positive strategies for creating the good life” in a personally mean-
ingful way. It looks at how to identify our authentic values and ... drew a line in the sand and
said, ‘We’re in debt and we’re not going to get into any more debt.’ It
was a tense time. My husband wasn’t happy about it, and the children
were not initially happy about ... book to
help you figure out the values and qualities on which you want to base
your life, and how money can become a tool to facilitate that reality.
2 MONEY AND HAPPINESS
Julie earns $34,000 a...
- 258
- 358
- 0
T-Shirts and Suits A Guide to the Business of Creativity pptx
Ngày tải lên :
15/03/2014, 21:20
... in a pure way, free of the
constraints and pressures of business.
Perhaps it is better to separate earning a living on the one
hand and creativity on
the other so as to do each one to the ... need to assess our assets, reputation, knowledge of
the market and intellectual capital.
Evaluating Strengths and Weaknesses
Rather than simply attempting to write down all the
strengths and ... more than the sum total of
individuals’ expertise and belongs to the organisation rather
than (or as well as) the people working within it.
In a creative enterprise, constant learning and the...
- 117
- 486
- 0
The Idea Hunter: How to Find the Best Ideas and Make them Happen
Ngày tải lên :
15/03/2014, 23:18
... capacity to find great ideas and put
them into play.”
—Michael Raynor, director, Deloitte Consulting
LLP, and author, The Strategy Paradox and The
about innovation and what it takes to be an ‘idea
person.’ ... over the
past century.
There’s a larger point about the value of ideas big
and smal. It has to do with the profound difference
between a thing and an idea, between a mere
object and a creative act. ... is, to no smal degree, a measure of attitude, of
the realization that the best ideas exist outside of
your brain and are there for the taking.
So let the learning and the unlearning—begin.
—Andy
not...
- 375
- 567
- 0
Postal banking in the United States and Japan: a comparative analysis docx
Ngày tải lên :
29/03/2014, 07:20
... that a postal bank can play a
beneficial role as an alternative to mandatory insurance for household deposits. This was,
in fact, the reasoning that led postal savings to be accepted in the United ... postal savings bank. Advocates invariably cited the
predicament of rural citizens who lived many miles from a bank, and the lack of savings
facilities available in certain regions, particularly the ... justification of postal savings – in the United States as well as in Japan and Europe
– it has not proved to be the major source of demand for postal savings, even if it was
important to a few rural...
- 51
- 409
- 0
Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc
Ngày tải lên :
31/03/2014, 17:20
... standpoint and take natural
categories of nouns (concepts) as a base and
associate to it through case relation pairs of a
verb and its translation equivalent.
Let a structure of natural categories ... conceptual category,
,numbers of associated pairs of verb and its
translation equivalent are generally small and
can easily be found.
(3) Association of the pair of verb and its trans-
lation ... group to which we
associate the translation equivalent.
In this manner, we can find pairs of verb and
its translation equivalent for any noun belonging
to a given category. To summarize the advantage...
- 3
- 394
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part1 pot
Ngày tải lên :
18/06/2014, 20:20
... Financial audits attest to the fairness of the financial statements of agencies. They
examine the adequacy of the financial records and accounting and internal controls, and
they determine the ... facilities and community
correctional centers.
Additionally, the department contracts with the Correctional Corporation
of America and Dominion Management to house Hawaii inmates in
Oklahoma and ... the Auditor exercises no control function, and its authority is limited to
reviewing, evaluating, and reporting on its findings and recommendations to the Legislature and
the Governor.
THE AUDITOR
STATE...
- 10
- 374
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part2 docx
Ngày tải lên :
18/06/2014, 20:20
... an ACO to work overtime,
he/she asks the ACOs from the previous watch to fill the vacant post. At
the larger facilities (Halawa Correctional Facility and Oahu Community
Correctional Center) the ... federal and state laws, rules and regulations, and policies and
procedures.
3. To make recommendations as appropriate.
We audited the financial records and transactions and reviewed the
related systems ... Also, the average overtime
compensation for all employees at all facilities averaged $4,710 for the
fiscal year ended June 30, 2001. The department was not aware of the
situation and was unable to...
- 10
- 363
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part3 pot
Ngày tải lên :
18/06/2014, 20:20
... 2001.
Except as discussed in the preceding paragraph, we conducted our audit
in accordance with auditing standards generally accepted in the United
States of America and the standards applicable to financial ... version
www.adultpdf.com
23
Chapter 3: Financial Audit
The Auditor
State of Hawaii:
We have audited the combined financial statements of the Department of
Public Safety, State of Hawaii (department), as of and for the ... back to
the department because the Judiciary was not able to locate the victim.
These payments were credited back to the inmates’ accounts.
In addition, facility and fiscal staff informed us that...
- 10
- 372
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part4 pptx
Ngày tải lên :
18/06/2014, 20:20
... estimates and assumptions that
affect the reported amounts of assets and liabilities and disclosures of
contingent assets and liabilities at the date of the combined financial
statements and the reported ... described above is a material
weakness.
This report is intended solely for the information and use of the Auditor,
State of Hawaii, and the management of the department and is not
intended to be and ... the State
Legislature that permit a state agency, within established fiscal and
budgetary controls, to incur obligations and to make expenditures.
Appropriations are allotted quarterly. The allotted...
- 10
- 397
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part5 pptx
Ngày tải lên :
18/06/2014, 20:20
... State
believes that, given the inherent variability in any such estimates, the
reserves are within a reasonable and acceptable range of adequacy.
Reserves are continually monitored and reviewed, and as settlements ... required to
contribute to both options at an actuarially determined rate.
Measurement of assets and actuarial valuations are made for the entire
ERS and are not separately computed for individual participating
employers ... issues a
publicly available financial report that includes financial statements and
required supplementary information. The report may be obtained by
writing to the ERS at City Financial Tower,...
- 10
- 504
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part6 pot
Ngày tải lên :
18/06/2014, 20:20
... level. It is the Wardens' responsibility to ensure that their
watch commanders are making appropriate decisions.
Patterns of Absence Due to Sickness Program
The audit report states that the ... must find another woman to fill the vacancy,
even if that woman will be on overtime, and even if there is a male ACO available
on regular time. On the Big Island, the HCCC transports inmates from ... certain
level of coverage to maintain security and safety.” The department notes
that some facilities, especially the Women’s Community Correctional
Center and the Hawaii Community Correctional...
- 10
- 365
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part7 ppt
Ngày tải lên :
18/06/2014, 20:20
... unfortunately the reality. We are fully aware of the problem
and of what it will take to arrive at a solution, and we are making every effort to
address it.
Nevertheless, we are pleased to report that ... of
overtime that the ACO has already worked. The Department worked with the
UPWon the procedures for assigning overtime work on a fair and equitable basis
for the larger facilities, Oahu Community Correctional ... and Maui Community Correctional Center (MCCC). In addition,
Kulani and Kauai Community Correctional Center have historically had lower
rates of overtime. The Wardens at these facilities have been...
- 5
- 352
- 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
Ngày tải lên :
20/06/2014, 01:20
... AGCAGU
AGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA
NS/1 6A( 5U) AGCAGGAGCAAGGGGA
UUUUU AACUUUGGAAUAACAACUUAAAACAAUUA
NS/1 6A( 6U) AGCAGGAGCAAGGGGA
UUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA
PB2 AGCAGUAGCAAGAGGAUUUUUA
PB2/6U ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA
UUGUCUCAA(UCA)
NP AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC
UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA)
M AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA)
NS
b
AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA)
a ... AGCAGUAGCAAGAGGAUUU(UUA)
PB1 AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG
CCCCUCC(UCA)
P3 AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA)
HEF AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA
UUGUCUCAA(UCA)
NP...
- 11
- 427
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2