fill in the blank with a suitable word or phrase in the box
1186 complete with a suitable word
... _TO BED EARLY TODAY BECAUSE I TO BE READY AT 6.30 A. M!! I’LL WRITE YOU SOON LOVE SABRINA DEAR ANDREW, WE ARE HAVING A KARATE CLASS IN THE CLUB THISAFTERNOON IT BEGINS AT O’CLOCK AND FINISHESTWO ... TO THE CINEMA LAST NIGHT ANDMUST DO IT TODAY HAVE A GOOD TIME!! EDDIE DEAR TEACHER, I M SORRY I CAN’T COME TO CLASS TODAY I HAVE TO STAY AT HOME FOR A WEEK BECAUSE I HAD A SMALL OPERATION I HOPE ... THAT WE CAN GO TOGETHER SHALL WE GO SKIING TO A TROPICAL ISLAND TO ENJOY THE BEACH AND THE SEA? PLEASE GIVE ME AN ANSWER BY THE END OFTHE MONTH ANGIE DEAR ANGIE, I’D LOVE TO GO ON HOLIDAY WITH...
- 6
- 232
- 0
Choose the underlined word or phrase that needs....
... Hanh and her mother have got home from the market just A B C D 63 What is Santa Claus based in? A B C D 64 Mr Robinson wants some marigolds because they are traditionally at Tet A B C D 65 A ... that really annoys me A B C D 53 It was very kind for her to lend me a bike A B C D 54 Jenny said that they are having a birthday party that night A B C D 55 My mother asked me how many classes ... helping you with your homework? A B C D 50 Meat must keep in a refrigerator or it will spoil A B C D 51 There is a cat sitting in the middle to the road A B C D 52 Tom is always forget his keys and...
- 4
- 1,035
- 3
Báo cáo khoa học: "Word or Phrase? Learning Which Unit to Stress for Information Retrieval∗" doc
... relaxing the word independence assumption based on the cooccurrence information of words in text Although those approaches theoretically explain the relation between words and phrases in the ... because the importance of the modifier word in retrieval is subordinate to the relation to its headword, but the headword is not in many phrases For example, in the case of the query ‘tropical storms’, ... is a parameter that controls the impact of the phrase probability against the word probability in the retrieval model 3.2 Adding Multiple Parameters Given a phrase- based retrieval model that...
- 9
- 343
- 0
Interview with a famous explorer fill in the correct tenses t 17
... found (find) me a job on a ship and at the age of 17 I arrived (arrive) in Africa! Interviewer You have travelled (travel) to the most interesting countries in the world Have you ever had (you, ... (sit) in the school library and I was reading (read )a book about South Africa Suddenly I saw (see) a picture of Lake Victoria and at that moment I decided (decide) to become an explorer Interviewer ... go) to Lake Victoria? Sir Guy Well, after I had left (leave) school at the age of 15, I lived (live) with my uncle for two years He was (be) an old man then, but he had been (be) a sailor all his...
- 2
- 465
- 0
Hoc T.a qua bai hat (fill in the blanks)
... Make a ………………… space to make a better place.* * * (fade) Heal the world we live in - You and for meSave it for our children -You and for me- Heal 10 I have a dream – Westlife I have a dream, a ... smile and the rain is gone Can …………… believe it (yeah) There's an angel ……………… next to me, reaching for my heart Just a …………… and there's no way back Can hardly believe it (yeah) But there's an angel ... ………………… for me I cross the stream, I have a dream I have a dream, a fantasy To help me ………………… reality And my destination ……………… it worth while Pushing through the darkness, still another mile...
- 3
- 655
- 1
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The ... unfilled data points represent the proteins that are produced in Rosetta(DE3) The data are based on measurements performed with two separately cultured samples The average error in the fluorescence activated ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and...
- 11
- 445
- 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt
... estimates for uniform order statistics The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks ... Informatics, Bulgarian Academy of Sciences Finally, the author acknowledges the referee for a thorough reading of the paper and for helpful suggestions This work was partially supported by National Science ... 1, 2, 3, and in Section The first step in all estimations is to relate the average behavior of τ (n, y, z), which contains local information about the divisors of n, with average behavior of functions...
- 68
- 409
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... being minimal the trapping of two main-chain conformations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in uence the dynamics of the ligand ... 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... involving dissociation of the axial Met ligand This results in deprotonated protein based ligands such as Lys, His and if available the N-terminal a- amino group competing for the vacant coordination...
- 15
- 509
- 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
... of a fluorinated alcohol, hexafluoroisopropanol (HFIP) HFIP has been chosen as a result of a vast exploratory search because it can dissolve Ab-(1–42) better than all other media and, at the same ... high performance liquid chromatography using a Polymer Laboratories PLRP-S polymer-based reversedphase column The column was maintained at 45 °C and perfused at a flow rate of mLỈmin)1 with a mobile ... content, as a function of water percentage in the mixture The ellipticity increases with the water concentration, reaching a plateau at approximately 20% water Correspondingly, the helix content, as...
- 7
- 624
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... Ala forward Phe700 fi Ala reverse Phe718 fi Ala forward Phe718 fi Ala reverse Val736 fi Ala forward Val736 fi Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC ... TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA ... b-DG(654–750), and Asat and A0 are the absorbances at saturation and in the absence of ligand, respectively Data were normalized according to the equation (Ai ) A0 ) ⁄ (Asat ) A0 ) and reported as fractional...
- 15
- 337
- 0
Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc
... Synechococcus) have no descendant in plants: large scale alignments including more bacterial sequences (available at the EMBL-Align database as ALIGN_000912) place the origin of the eukaryotic ClpP2 within ... Guillardia theta (Gt, a Cryptophyte) and Thalassiosira pseudonana (Tp, a Diatom) The Viridiplantae (green, of a lighter shade for chloroplast genes) are Arabidopsis thaliana (At), Chlamydomonas ... for ClpP1 which is plastid-encoded in green algae and vascular plants, i.e the green lineage of plants ClpP genes are also found in Cyanobacteria [22] and in the genome of the Cyanophora cyanelle,...
- 14
- 436
- 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... of the microorganism to carrot (host) cells, this being an early step in crown gall tumor formation [31] A lipopolysaccharide from Pseudomonas corrugata, a plant pathogenic bacterium, contains ... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component of the cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined ... accommodate actinobacteria isolated from narrow reed grass infected by nematode Heteroanguina graminophila Int J Syst Evol Microbiol 51, 2073–2079 Nadano, D., Iwasaki, M., Endo, S., Kitajima, K., Inoue,...
- 6
- 561
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... 5¢ interface between cDNA and pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For ... was estimated from the response ratio for proline, which was calibrated against the bicinchoninic acid assay (4–6 matched cell dishes) for each MS session Northern blot analysis Northern analysis ... curve, obtained by weighted linear regression For radiotracer assays, protein was measured by the bicinchoninic acid assay [25] with bovine serum albumin as standard The protein content of MS samples...
- 8
- 331
- 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
... Phosphatase-treated nuclear extracts were assayed for their DNA-binding capacity in standard EMSA UV crosslinking of DNA–protein adduct The EMSA reaction was carried out using ng labelled Jun)25 and ... DNA-binding domain in an active conformation RLjunRP is an 40 kDa protein that forms an 80-kDa protein–DNA adduct To assess approximate molecular mass of the factors interacting with the )148 to ... replaced with mL normal growth medium and incubated at 37 °C in a 5% CO2 incubator for an additional 48 h Medium was again removed and the cells were rinsed with NaCl/Pi followed by an incubation...
- 9
- 449
- 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt
... the two chains, and 11 (chain A) or 13 (chain B) C-terminal residues including the hexahistidinyl tags also appear unstructured The binding site region of chain B contains additional electron ... main chain and side chain, in the bound peptide In addition, there is a water molecule occupying the hydrophobic pocket for the terminal leucine Moreover, there is an intriguing switch involving ... situation for non-PDZ protein interaction domains in PSD-95: an intramolecular interaction between a ‘hook’ domain and guanylate kinase domain keeps the molecule in a closed state [28,29] In conclusion,...
- 11
- 458
- 0
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
... histological subtype and histological grade Information regarding clinical stage was obtained from the medical charts, following the standardized FIGO classification of tumor staging Information ... residual tumor after surgery was not available Standard adjuvant therapy was platinumbased chemotherapy, from the 1990s given in combination with paclitaxel whereby = negative, = intermediate and ... Cisplatin acts by forming covalent bonds with purine DNA bases which causes cross-linking of DNA and results in activation of several signal transduction pathways involved in DNA-damage repair,...
- 12
- 531
- 0
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
... on the k3 (internalization) 68Ga-DOTATOC was better suited than 18F-FDG for the diagnosis of metastatic NETs The 68 Ga-DOTATOC uptake was also used as a parameter for a radionuclide therapy with ... Concerning the 68Ga-BZH3 kinetics, k1 is a parameter that reflects the receptor binding and k3 is a parameter that reflects the internalization of the tracer A lower receptor binding of 68Ga-BZH3 was ... qualitative analysis of SUV and quantitative evaluation based on the compartmental analysis of kinetic parameters [2] However, not all tumors are 18F-FDG avid, and in particular treated tumorous...
- 23
- 350
- 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
... Boas MHA: Northern Uganda IDP Profiling Kampala: UNDP/ GoU/FAFO; 2005 Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf .or. jp/news/baseline/Baseline.pdf] ... significance was assumed for P values < 0.05 for all tests All statistical analysis was performed using STATA version 9.2 (Stata Corporation, College Park, Texas, USA) and adjusted for the clustered ... pre-testing to check for errors or problems The data collectors were all fluent in Luo and English A final forward and back-translation was then produced and a final review conducted by the study team...
- 10
- 647
- 0
báo cáo hóa học: " The health-related quality of life in rheumatoid arthritis, ankylosing spondylitis, and psoriatic arthritis: a comparison with a selected sample of healthy people" potx
... Disease activity in patients with AS and axial PsA was measured with the BASDAI [24] The BASDAI consists of VAS relating to major symptoms relevant to AS: fatigue, spinal pain, joint pain, localized ... for categorial variables and analysis of variance (ANOVA) for continuous variables Standardized difference scores (the s-score or normal score) were also calculated by subtracting the mean scores ... disease impact on mental health was considerable A management programme for patients with IRD and the planning of the healthcare services should take these findings into account by maintaining the...
- 12
- 466
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... cortical inhibition are therefore appealing for augmenting motor learning in behavioral therapies [38-40] Here we present data supporting the idea that depending on the nature of the training and ... motor training In fact such protocols aim to augment the sustained changes in synaptic efficacy brought about through training, by altering motor cortex excitability during or before training ... that the short-term plasticity we observed shares a spinal, as well as cortical component Previous findings of rapid plasticity using a similar training paradigm were attributed to changes at the...
- 8
- 432
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25