faul in a car
Off the Rim Basketball and Other Religions in a Carolina Childhood docx
... becomingrear admiral, had captained the football team and madeone or two All-American squads at the Naval Academy in 1931, before surviving Pearl Harbor in 1941 and com-manding the ship—he later told ... in action—particularlyBilly Cunningham, a 6'5" leaper from Brooklyn alreadybecoming known as the Kangaroo Kid, and Jay Neary, a slick guard also from New York. Cunningham andNeary—as ... forhimself in the days when teams such as Trinity and Van-derbilt and Sewanee held their own with Georgia andAlabama and Tennessee, when Duke went to the RoseBowl after hiring away Alabama’s famous...
- 260
- 492
- 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
... glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trialGisela Del Carmen De La Rosa1, Jorge Hernando Donado2, Alvaro ... Alvaro Mauricio Quintero3, Luis Gabriel González3, Nora Elena Saldarriaga4, Marisol Bedoya1, Juan Manuel Toro5, Jorge Byron Velásquez4, Juan Carlos Valencia4, Clara Maria Arango5, ... Arango5, Pablo Henrique Aleman1, Esdras Martin Vasquez4, Juan Carlos Chavarriaga4, Andrés Yepes4, William Pulido4, Carlos Alberto Cadavid1 and Grupo de Investigacion en Cuidado intensivo:...
- 9
- 635
- 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... clinically relevant and irrelevant findings, and simplyreported on all abnormalities [12]. At present, in many ICUsCXRs are still routinely obtained on a daily basis, at least in TheNetherlands ... 22:1335-1338.9. Chahine-Malus N, Stewart T, Lapinsky SE, Marras T, Dancey D,Leung R, Mehta S: Utility of routine chest radiographs in a med-ical-surgical intensive care unit: a quality assurance survey.Crit ... [summarized in Table 1] were absent orpresent and, if an abnormality was present, whether it wasjudged to be an 'old' or 'new' finding). In case an abnormalitywas worsening,...
- 7
- 722
- 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... quality assurance surveyNatalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta MehtaMount Sinai Hospital, Toronto, Ontario, CanadaCorrespondence: ... beneficial to patient care. Brainsky et alobserved that 20% of routine CXRs performed in a medicalICU had ‘major important’ findings, and 8% prompted a change in management [4]. The majority of changes ... Gray et al found that clinicians werefairly accurate in determining the placement of subclavian orinternal jugular (IJ) vein pulmonary artery (PA) catheter intro-ducer sheaths, but the clinicians...
- 5
- 506
- 0
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... 3,4, Tatsuya Okuno 3, Naoko Chayahara 3, Ikuya Miki 3, Takao Tamura 3, Tsubasa Inokuma 2, Yoshiji Takemoto 2, Tsutomu Nakamura 3, Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 ... M, Manda R, et al. Efficacy and toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas. Anticancer Res. 2003; 23: 3493-8. 15. Yamada H, Maki H, Takeda Y, ... et al. Evaluation of combined nedaplatin and docetaxel therapy for human head and neck cancer in vivo. Anticancer Res. 2006; 26: 989-94. 16. Yamashita H, Nakagawa K, Tago M, et al. Radiation...
- 7
- 531
- 0
Tài liệu ALLOCATION TO REPRODUCTION IN A HAWKMOTH: A QUANTITATIVE ANALYSIS USING STABLE CARBON ISOTOPES docx
... oocytes was counted (as in Dunlap-Piankaet al. 1977).Statistical analysesAll statistical analyses were performed in JMP ver-sion 3.1 (SAS Institute, Cary, North Carolina, USA).Means are presentedϮ1SEunless ... (Intake rate)ϫand mixes with a fractional turnover rateof [(Intake rate)ϫ]/V.Carbon is lost from the mixing and nonmixing pools at the rate of (Egg laying rate)ϫ␣and (Egglaying rate)ϫ(1Ϫ␣), ... with AN-OVA, including sugar type, day, and the interactionbetween sugar and amino acids as effects. The decline in meal size over time was tested with linear regression.Nonparametric Spearman...
- 10
- 434
- 0
Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx
... Medical City, Riyadh, Saudi Arabia (Abdullah A. Alshimemeri, Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, and Othman Al Harbi) and Ministry of Health, Riyadh, Saudi Arabia (Ziad Memish)Address ... Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, Othman Al Harbi, Ziad MemishCrit Care & Shock (2011) 14:1-6AbstractObjective: To examine the presentation and outcome of patients diagnosed ... percentages of groups where applicable. Variations within categories are shown as means with ranges where appropriate. Comparative data between characteristics are displayed, and data are summarized...
- 6
- 506
- 0
Tài liệu Nursing Documentation in Aged Care: A Guide to Practice pdf
... regional telerehabilitation project; post-acute-care programs in regional hospitals; care-planning in rural areas utilising critical-pathway methodology; and community nursing clinical pathways ... degrees in applied science and theology, a master’s degree in theology, a graduate diploma in gerontic nursing, and a PhD. After a long and distinguished career in clinical and academic nursing, including ... holds a graduate diploma and a master’s degree in health science. Since 1994, she has worked as a project manager and acting operations manager at the Collaborative Health Education & Research...
- 354
- 693
- 1
Tài liệu BUSINESS START-UP & RESOURCE GUIDE STARTING A BUSINESS IN NORTH CAROLINA doc
... important to evaluate all aspects of your business concept and to continually balance your ideas against reality. After defining and refining your business idea, does it still look like a good ... business. HARASSMENT: The government and the courts are taking a strong position in trying to discourage harassment in the workplace. Harassment, including sexual harassment, can take many ... is one that you obtain from a bank and pay back in monthly installments. A personal bank loan can either be secured (collateral is required as a guarantee that you will repay the loan) or unsecured...
- 58
- 501
- 0
PROCEDURES ON IMPORTATION AND REGISTRATION OF A CAR IN SINGAPORE doc
... technical catalogue, etc.). Step 3 Arrange for shipment of the car to Singapore with a shipping agent. Step 4 Arrange with your shipping agent to obtain an Inward Cargo Clearance Permit. ... profile printout of the Club/Association/Organisation or other certificate issued by the relevant regulating authority and original NRIC (Singaporean, Singapore PR and Malaysian) or Passport ... i) Valid Inward Cargo Clearance Permit; and j) Original Purchase Invoice or Manufacturer/Factory Invoice. Pay the total of the following fees via Cashier’s Order, NETS or Cash: a) Processing...
- 23
- 533
- 0
Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot
... Manuals in a Monte-Carlo FrameworkS.R.K. Branavan David Silver * Regina BarzilayComputer Science and Artificial Intelligence LaboratoryMassachusetts Institute of Technology{branavan, regina}@csail.mit.edu* ... built -in AI.7 ResultsGame performance As shown in Table 1, our lan-guage aware Monte-Carlo algorithm substantiallyoutperforms several baselines – on average winning53.7% of all games within ... versa, in a cycle of continual improvement (Suttonand Barto, 1998). In many games, it is sufficient to maintain a dis-tinct action-value for each unique state and action in a large search tree....
- 10
- 508
- 0
Báo cáo khoa học: Characterization of isocitrate dehydrogenase from the green sulfur bacterium Chlorobium limicola A carbon dioxide-fixing enzyme in the reductive tricarboxylic acid cycle ppt
... purificationof the recombinant enzyme In order to c onstruct an expression vector for Cl -idh,twooligonucleotides (sense, 5¢ -A AAAACATATGGCAAGCAAATCGACCATCATCTACAC-3¢, and antisense, 5¢-AAAAAGGATCCCGGCTGAAAACCGGGCTGCATTA-3¢)were ... sequenceswere obtained with the programALIGNcontained within theCLUSTALWprogram provided by DNA Data Bank of Japan(DDBJ). The sequence data was analyzed usingGENETYXsoftware package (Software Development, ... fumarate, m alate, glyoxylate, ATP, and ADPgave no significant effect on the carboxylation reaction(data not shown). H owever, considerable inhibition wasobserved when oxaloacetate was added into...
- 6
- 481
- 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf
... EducationMinistry of EducationAntigua and BarbudaThe BahamasBarbadosBarbadosBelizeDominicaGrenadaGrenadaGuyanaJamaicaJoint British and Dutch overseasTerritories (Anguilla)Joint ... the Bahamas, Barbados, Grenada,Guyana, Jamaica and Trinidad and Tobago, support is given to a Sector Wide Approach (SWAP) in education with one nationalsectoral plan including all education ... and HIV AnguillaAntiguaThe BahamasBarbadosBelizeDominicaGrenadaGuyanaJamaicaSt. Kitts & NevisSt. LuciaSt. Vincent & GrenadinesTrinidad & TobagoPolicy and Strategies✓...
- 40
- 450
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGCPPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTGMicroRNA-373 functions as an oncogene in ... TTTTTATTGTGGAGTATGCTGCTGAAATGPPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6,functions as an oncogene in hepatocellular carcinomaNannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong andHua...
- 11
- 396
- 0
Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx
... the backbone of tuberculosis (TB) laboratory investigations in tertiary healthcare facilities which have a large number of cases and financial constraints. The present study aimed to re-evaluate ... used as an aid in the diagnosis of mycobacterial disease for many years. It is the simplest procedure currently available to detect AFB in clinical samples by ZN staining. As seen in Table ... detection of AFB in sputum samples of patients with pulmonary tuberculosis in tertiary healthcare facilities which have a large number of cases and financial constraints. Ethical Approval The...
- 6
- 465
- 0
- windows xp in a snap
- bản vẽ mạch in trên card
- security exams in a nutshell
- free nucleotides in living cells play important roles in a variety of biological reactions
- bchj and bchm interact in a 1 1 ratio with the magnesium chelatase bchh subunit of rhodobacter capsulatus
- kỹ thuật in ấn
- stocking a pond with fish in north carolina
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25