exchanger a porous metal structure and a plate and fin heat exchanger applied to preferential co oxidation
Báo cáo y học: "Tibialis posterior in health and disease: a review of structure and function with specific reference to electromyographic studies" pot
... http://www.jfootankleres.com/content/2/1/24 structures Ultrasound imaging facilitates real-time observation of the insertion and identification of the neurovascular bundle and anatomical variants A recent ... JW and DET critically revised the manuscript All authors read and approved the final manuscript Additional material Additional file Posterior approach A video demonstration of the posterior approach ... a cadaveric study Foot Ankle Int 2003, 24:780 Sarrafian S: Anatomy of the foot and ankle: descriptive, topographic, functional 2nd edition Philadelphia: Lippincott; 1993 Agur A, Dalley A: Grant's...
- 8
- 530
- 0
Computational modeling of cell signaling dynamics hypothesis management and parameter estimation methods applied to the akt pathway
... unknown rate constants increases with larger pathways, the parameter Page space becomes astronomical and the estimation is often too computational costly to be practical or too inaccurate to give ... information about signaling pathways, including Science Signaling’s Database of Cell Signaling (AAAS and Stanford, 2012), KEGG PATHWAY database (Kanehisa, et al., 2012), SignaLink (Farkas, et al., ... blotting, confocal imaging), and partly to bring the data to the same scale as described by earlier model (Hatakeyama, et al., 2003) Time series data (Akt total, Aktp308, PIP3, and PDK1) were rescaled...
- 156
- 383
- 0
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... chorismate mutase by combinatorial mutagenesis and selection: the importance of electrostatic catalysis Proc Natl Acad Sci USA 93, 5043–5048 11 Haslam, E (1993) Shikimic Acid: Metabolism and Metabolites ... Structural elements such as the a/ b interface, loops connecting secondary structures and a- helix caps were found to be permissive In contrast, b-strand stop signals (particularly Gly), the central core...
- 8
- 635
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... interfaces within neuronal nAChR subunit combinations (compare Fig 2A C) So far, a- conotoxins selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI) ... neuronally active a- conotoxins Assay-based and cDNA-based strategies The first a- conotoxins were identified using bioassays such as intraperitoneal (neuromuscular nAChRs) or intracranial (neuronal nAChRs) ... loop and nanomolar activity on a3 /a6 containing nAChRs) and EpI and ImI (SDPR motif in the first loop and nanomolar activity on a7 nAChRs) It remains to be determined if these a- conotoxins share a...
- 15
- 757
- 0
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
... such mild acidic conditions are unlikely to alter the conformation signi®cantly The backscattered Raman and ROA spectra of the wild-type and mutant tau46 are shown as the top and bottom pairs, respectively, ... protein to be the same as the molten globule state as the latter is almost as compact as the folded state (radius of gyration and hydrodynamic radius » 10±30% larger), has a hydrophobic core and contains ... contain substantial amounts of the PPII helical conformation (see below), these b- and jcasein ROA bands are therefore assigned to PPII structure The positive ROA bands in b- and j-casein at »...
- 9
- 667
- 0
Making monitoring and evaluation systerms work a capacity development toolkitInteractive textbook at www/worldbank.org/pdt1. Structure and Organizational Alignment for M&E pptx
... of each c) Develop a national evaluation and research strategy d) Ensure that research and evaluations are done in an ethical way e) Develop and/ or update a national evaluation and research agenda ... of sampling Six routine data Data sourcing, data collection, data collation, data management analysis, data reporting, and data use processes SPSS Statistical Package for Social Sciences SQL Structured ... Spatial analysis software is useful as part of a database 329 5.7 Linkage to other databases 331 5.8 Need for capacity building in database design and management to improve use of, and access to...
- 530
- 2,030
- 0
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx
... C Toxicol Pharmacol 139, 295–301 19 Martins RD, Alves RS, Martins AM, Barbosa PS, Evangelista JS, Evangelista JJ, Ximenes RM, Toyama MH, Toyama DO, Souza AJ et al (2009) Purification and characterization ... PLA2s than UcPLA2 (Fig 3A) Other known cnidarian PLA2s, such as those from the hydrozoan Hydra magnipapillata [34] and the sea anemones A pallida [16,17] and B caissarum [19], as well as the PLA2 ... analysis has demonstrated that group I PLA2s are present in all major metazoan taxonomic groups Cnidarians, placozoans, protostomes and basal deuterostome lineages (echinoderms, cephalochordates, and...
- 13
- 462
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... and Crystal structure of Staphylococcus aureus EF-G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... a Pilatus detector Later, a 1.9 A resolution dataset was collected at beamline ID14-1, ESRF (Grenoble, France), with an ADSC Q210 CCD detector Data were ˚ collected at 100 K and 0.9334 A Data...
- 15
- 474
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria ... (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria ... characteristics of transthyretins and TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled...
- 13
- 390
- 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx
... ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA CAGCAACGCAAGCTT CAGCAACGCAAGCT CAGCAACGCAAG AGAGATTTTCCACAT CTAGAGATTTTCCACAT TGCTAGAGATTTTCCACAT TGACAAGGATGGCTGGTGGGACTTAGCGTA ... TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT GTCCTAGCAAAGCGTATGTGATCACTGG GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC ... TGCTGTCTAGAGACTATCGC GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC GGACATCTTTGCCCACGTTGACCCG ATCTTTGCCCACGTTGACCCG TTGCCCACGTTGACCCG GCGATAGTCTCTAGACAGCATGTCC of the archaeal FEN-1 homologues have assisted...
- 14
- 433
- 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... were made with PYMOL [47] able sequences, some bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six ... concentrations were determined according to Bradford with the Bio-Rad Protein Assay Kit (Bio-Rad, Hercules, CA, USA) with BSA as a standard Analyses of the specific activity against chitooligosaccharides ... NY, Cohn L, Hamid Q & Elias JA (2004) Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation Science 304, 1678– 1682 Kasprzewska A (2003) Plant chitinases ) regulation...
- 12
- 399
- 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ The mutation (codon underlined above) was confirmed by DNA sequencing on Applied Biosystems Sequencer 37 3A ... 188–122) A large difference is centred on Met121 In particular, the mean B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms ... The aqueous phase was collected and concentrated on a rotary evaporator until a solid powder appeared The solid powder was stored desiccated at )20 °C The course of the reaction was followed and...
- 9
- 556
- 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... 1–17 and 24–34 by daN and dNN cross-peaks As an a- helical secondary structure was assumed from chemical-shift arguments, daN(i,i+3) and daN(i,i+4) NOE cross-peaks were used, leading to the assignment ... indicated by rectangles as both contain a second HN in the side chain The N-terminal Gly1 appears as a weak and very broad peak All Ha chemical shifts of residues 5–31 show an upfield shift compared ... restraints, full charges, and a dielectric constant set to e ¼ 4rij using a heating and cooling protocol Figure shows MOLMOL stereographic projections [19] of the heavy atoms of rSP-C (FFI) The structure...
- 10
- 426
- 0
Electronic structure and magneto optical properties of solids v antonov, b harmon, a yaresko
... description of the metal- insulator transition and strongly correlated metals, in some cases, such as the metal- insulator transition in FeSi and LaCoO3 , LDA+U calculations gave valuable information by ... problems in quantum–mechanical many– particle systems: macroscopic many–particle systems and atomic systems or clusters of several atoms Macroscopic systems contain N ≈ 1023 particles and effects ... gradient expansion for the exchange-correlation hole around an electron Later Perdew and coworkers argued that the gradient expansions can be made more realistic via real-space cutoffs chosen to...
- 545
- 509
- 0
Báo cáo khoa học: Human haptoglobin structure and function – a molecular modelling study pptx
... immediate clearance of free Hb, acts as an antioxidant agent [37] An additional activity of HPT is related to its ability to suppress heat- induced and oxidative stress-induced unfolding and precipitation ... of haptoglobin receptors in human hepatoma cells Biochim Biophys Acta 1136, 143–149 20 Oshiro S, Yajima Y, Kawamura K, Kubota M, Yokofujita J, Nishibe Y, Takahama M & Nakajima H (1992) Catabolism ... covalent dimer and the HPT2 covalent trimer were constructed using the molecular graphics package Discovery Studio visualizer 1.7 (Accelrys Software Inc., San Diego, CA, USA) and the rototranslation...
- 9
- 362
- 0
Báo cáo khoa học: Solution structure and internal dynamics of NSCP, a compact calcium-binding protein doc
... requires structure and dynamic characterization in solution of the various functionally relevant states To achieve this aim, we initiated a structural and dynamics analysis of Ca2+-saturated NSCP ... III and IV The restraint statistics are detailed in Table The aqua and procheck-nmr programs [12] were used to analyze the restraint violations and to estimate the precision and quality of the structures ... spectroscopy and cristallography J Mol Biol 226, 239250 Yamasaki K, Saito M, Oobatake M & Kanaya S (1995) Characterization of the internal motions of Escherichia coli ribonuclease HI by a combination...
- 15
- 292
- 0
Organizational Structure and Performance in European Banks: A Reassessment pptx
... types and first include all financial intermediaries that were classified as cooperative banks, commercial banks, savings banks, real estate / mortgage banks, bank holding and holding companies, and ... level and subsidiaries Same regional-level aggregation applies, for instance, to German and Austrian co- operative banks, whereas for the Netherlands and Finland – where both countries have important ... turn, are present mostly in Spain and Norway (for Spanish savings banks, see Hasan and Lozano-Vivas (2002) and Garcia-Marco and Roblez-Fernandez (2008); for Norwegian savings banks, see Bøhren and...
- 25
- 424
- 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx
... 25 Kamijima T, Ohmura A, Sato T, Akimoto K, Itabashi M, Mizuguchi M, Kamiya M, Kikukawa T, Aizawa T, Takahashi M et al (2008) Heat- treatment method for producing fatty acid-bound alpha-lactalbumin ... (ER), a- lactalbumin is transported to the Golgi apparatus, where it binds to the galactosyltransferase complex and acts as a substrate specifier in lactose production The a- lactalbumin gene has been ... complex on an ion exchange column conditioned with oleic acid [2] The complex was named HAMLET and was defined as a complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin...
- 12
- 525
- 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG ... GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC pPic9Kmpaf pPic9Kmpaf pPic9Kmpaf pPic9KpafK3 8A pPic9KpafK35,3 8A FEBS Journal 276 (2009) ... sites for inframe cloning into the pPic9K expression vector (forward 5¢-AGCTCGAGAAAAGAGCCAAATACACCGGAAAA TG-3¢, XhoI site underlined; reverse 5¢-CTGAATTCCTA GTCACAATCGACAGCGTTG-3¢, EcoRI site underlined,...
- 16
- 408
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25