example—stabilizing a discontinuous mode flyback converter
Research on a novel buck boost converter for wind turbine systems
... inductor are identical and there is no magnetic leakage The only differences between Mode and Mode are that in Mode 3, the grid is in the negative half cycle and the discharging current has an opposite ... inverters can accommodate a wide range of input dc voltage for an improved energy output from variable wind turbine resources The input source and the output grid are separated based on flyback operation ... Then similar arguments regarding energy exchange and transfer in Mode can be also applied to Mode As a result, in the NHC of ac output, the energy is transferred from dc source to ac grid through...
- 6
- 416
- 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
... of the available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor they parallel the findings on the noncanonical class IIIc AC Rv1900c ... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate ... because the canonical amino acids which define substrate specificity are replaced in a nonconservative manner, glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs...
- 8
- 401
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are shown in ... Discussion and conclusion In the stationary operation of two -mode random microlaser, the variation of laser parameters influences clearly on the transformation of mode photon densities With each parameter, ... photon densities of mode and These equations (1), (2) have been solved numerically by the Matlab language with chosen values of parameters shown in Table (as seen in [12]) Table α1 = 1.1 β1 =...
- 4
- 343
- 0
Writing a Business Plan: An Example for a Small Premium Winery potx
... coordinating winery operation and Manager maintenance, sales, marketing, financial record keeping, and staffing General Manager Coordinate winery operation and maintenance, sales, marketing financial ... experiences and January recommendations for a lawyer (3) Send to BATF and SLA for application packets January (4) Hire a lawyer to help with the application process February (5) Have all forms and paperwork ... Management January/February 1999 Barclay, Veronica “Are You Marketing to the Affluent.” Vineyard and Winery Management January/February 2000 Bizplanit www.bizplanit.com Bureau of Labor and Statistics...
- 49
- 507
- 1
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
... GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) ... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT ... mutagenesis (Qiagen, Crawley, UK) Primers used were: KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG...
- 12
- 445
- 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
... to favour a similar mode of binding for Ac-OPP and Ac-CoA Binding mode of CoA to thiolases oxidized or acetylated at Cys89 The structure of CoA-complexed Z ramigera thiolase, in which the catalytic ... site G Merilainen et al ¨ Table Calorimetric analysis of CoA binding to the Z ramigera biosynthetic thiolase at 25 °C The values and error estimates are calculated from separate measurements (three ... 15543–15556 Davis JT, Moore RN, Imperiali B, Pratt AJ, Kobayashi K, Masamune S, Sinskey AJ, Walsh CT, Fukui T & Tomita K (1987) Biosynthetic thiolase from Zoogloea ramigera I Preliminary characterization...
- 13
- 472
- 0
Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx
... with the larger and richer knowledge domains which have to be handled The main conclusion of the paper is that the notions of processing capacity, memory constraints and control structure are the ... constitute the model of metaphor comprehension are common to many language understanding systems (Schank, Wilks, L)IR group, etc.) The comprehension of metaphor does not require a special set of processes ... the conditions necessary for the strategy to be employed CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing language comprehension systems...
- 2
- 311
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Control and implementation of a new modular matrix converter
... Vcap −Vcap −Vcap Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap Vcap −Vcap −Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap −2Vcap ... Phase A Phase a ap+ -Vc VAB = V Vab = Vcap Phase B Phase b Phase c Phase C -Vcap+ Phase A Phase a VAB = -Vcap VCA = Vcap Phase B Vab = Vcap +Vcap+V VBC = 0V +V Phase C +Vcap-Vcap+ Phase A + Phase ... + - A B C a b c vbc Phase c -Vcap+ Phase A + Vcap vab Phase c Phase C + Vcap Vcap Phase a Vab = Vcap VAB = -Vcap VCA = 0V Phase B VBC = Vcap Vca = 0V Phase b Vbc = -Vcap + - A B C vca a b c...
- 7
- 334
- 1
Báo cáo sinh học: " Research Article On an Inverse Scattering Problem for a Discontinuous Sturm-Liouville Equation with a Spectral Parameter in the Boundary Condition'''' pptx
... ds dz x t a z−x a a αx 1 1− − α a q z K z, s ds dz t z a a αx ∞ t z a a αx q z K z, s ds dz, a a αx t−z a a αx a; K x, t 1.23 t−z a a αx a 1 1− α for < x < a, t > −αx a; ∞ α 2α a ∞ q z ... t are obtained: K x, t α 1 4α 1 t,α 2α − α a αx a a t /2α ∞ a 1 1− α a a /α q z K z, s ds dz t−z a a αx q z K z, s ds dz, t z a a αx q z dz αx a a−t /2α q z dz a t−α z−x t a a αx /2 a t−αx ... of the scattered waves,” Doklady Akademii Nauk SSSR, vol 104, pp 695–698, 1955 V A Marchenko, Sturm-Liouville Operators and Applications, vol 22 of Operator Theory: Advances and Applications,...
- 17
- 289
- 0
Báo cáo sinh học: " Research Article On an Inverse Scattering Problem for a Discontinuous Sturm-Liouville Equation with a Spectral Parameter in the Boundary Condition" potx
... ds dz x t a z−x a a αx 1 1− − α a q z K z, s ds dz t z a a αx ∞ t z a a αx q z K z, s ds dz, a a αx t−z a a αx a; K x, t 1.23 t−z a a αx a 1 1− α for < x < a, t > −αx a; ∞ α 2α a ∞ q z ... t are obtained: K x, t α 1 4α 1 t,α 2α − α a αx a a t /2α ∞ a 1 1− α a a /α q z K z, s ds dz t−z a a αx q z K z, s ds dz, t z a a αx q z dz αx a a−t /2α q z dz a t−α z−x t a a αx /2 a t−αx ... of the scattered waves,” Doklady Akademii Nauk SSSR, vol 104, pp 695–698, 1955 V A Marchenko, Sturm-Liouville Operators and Applications, vol 22 of Operator Theory: Advances and Applications,...
- 17
- 352
- 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf
... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was ... transfer activities among various specialties In a study done on researchers in Canada it was seen that applied science researchers use plain and engaged dissemination measures more than basic ... 72 years, and the mean age was 45.6 years (SD = 9.4) Regarding academic rank, 15% of researchers were non-academic members, 7% were instructors, and 33%, 26%, and 19% were assistant, associate,...
- 8
- 341
- 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot
... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was ... transfer activities among various specialties In a study done on researchers in Canada it was seen that applied science researchers use plain and engaged dissemination measures more than basic ... 72 years, and the mean age was 45.6 years (SD = 9.4) Regarding academic rank, 15% of researchers were non-academic members, 7% were instructors, and 33%, 26%, and 19% were assistant, associate,...
- 8
- 315
- 0
Báo cáo y học: "Network motif analysis of a multi-mode genetic-interaction network" docx
... For instance, a particular GoSlim molecular function gene may be annotated as both a transferase and a protein kinase In enumerating a specific network pattern, we allowed genes sharing a single ... transcriptional regulator Ste12 Cdc42 is an upstream activator of the fMAPK signaling pathway, and Ste12 is a downstream transcription factor of the same pathway [9,10,34,35] This motif instance ... the cAMP pathway and additively with overexpressed components of the filamentation/invasion MAPkinase (fMAPK) pathway Statistical model of a null hypothesis Biologically relevant genetic-interaction...
- 12
- 298
- 0
Playing with tension a computational mode of improvisational accompaniment by secondary rhythmic performer in carnatic music
... validation of a tension model that, assuming restricted sowkhyam, is able to generate alternate variations of secondary accompaniment that are as valid as the original accompaniment Keywords : Carnatic ... retrieve accompaniment from a database of accompaniment patterns (Ganascia, Ramalho, and Rolland, 1999) It extracts metalevel descriptions of musical scenarios (such as the beginning and end of a bar), ... supporting and housing me as a graduate student for the last two years I thank the musicians, Dr Ghatam Karthik, Mr Trichur Narendran, Mr Arun Kumar, Mr Sumesh Narayan, Mr Sriram, Mr Hari, Mr Shrikanth,...
- 136
- 188
- 0
a first example of a lyotropic smectic c analog phase
... SmC Analog Phase Lyotropic liquid crystals tend to form layered structures, which are called lamellar phases Yet, the mesogens are usually parallel to the layer normal k (cf lamellar Lα phase, ... SmC analog phase, and later investigations of the system showed, that the phase was indeed a rather complex two dimensional correlated columnar phase [23, 24] Actually, there are only two examples ... analog phase is stabilized over a quite broad concentration range To prove the correct phase assignment of the lyotropic SmC analog phase, the authors provided X-ray diffraction data as well as...
- 130
- 333
- 0
A digitally controlled switch mode power supply based on matrix converter
... IEEE-IA TRANSACTIONS paper published in mid-year 1994 to mid-year 1995, the IEEE-IAS Magazine Prize Article Award in 1996, the Class of 2001 Texas A& M University Faculty Fellow Award for demonstrated ... Engineering, Chungnam National University, Daejeon, Korea His research interests are high power converter, ac/dc, dc/ac and ac/ac converter topologies, power quality and utility interface issues for ... power rating, is the peak of input voltage, and is angular input frequency and input current I RATANAPANACHOTE et al.: DIGITALLY CONTROLLED SWITCH MODE POWER SUPPLY Fig 13 129 Proposed matrix converter...
- 7
- 395
- 1
Báo cáo y học: "Cancer control through principles of systems science, complexity, and chaos theory: A mode"
... shifting battle zone between stagnation and anarchy…place where a complex system can be spontaneous, adaptive, and alive” [4] The similarity of a fractal pattern and cancer growth can be seen in a comparison ... degree of chaos in a healthy heart An electrocardiogram without a degree of chaos actually reflects an underlying cardiac abnormality, especially the lack of adaptability These observations support ... view that a perfect order is a non-physiological and a non-healthy state A degree of variability is essential to maintain a complex adaptive system A biologic entity in this range is in danger...
- 10
- 440
- 0
A relational SQL Example
... Entity relationship diagram for the sample HR database 8.3 Relational Database Design At this point, we have a theoretical analysis of the HR database Before we create a physical implementation, ... CHAR (or NCHAR) A fixed-length character type right-padded with space characters up to its constraining size VARCHAR2 (or NVARCHAR2) A varying-length character type that can hold as many characters ... 8.1 Relational Database Analysis Relational database analysis is a process whereby you identify and classify into groups the information you need to store in a database In addition, you...
- 11
- 288
- 1
Tài liệu Establish a Windows NT/2000 Authentication Mode docx
... only a few moments, and it affects all databases that SQL Server manages Steps SQL Server takes a layered approach to securing the data in its tables These layers include authentication-whereby a ... the databases you've created for them Technique Enterprise Manager includes all the dialog boxes that are required to set SQL Server's authentication mode Changing the authentication mode takes ... by username and password-and permissions on the objects (such as tables and views) stored in the database As a developer or SQL Server administrator, you must choose which authentication mode your...
- 4
- 280
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25