example of a write up of qualitative data analysis
starck, murtagh - handbook of astronomical data analysis
... methods, and by dimensionality mapping methods Multiband images can be taken as a particular case Such methods are pivotal in Chapter on multichannel data, on catalog analysis, and on data storage and ... with automatic decision making Typically, we have a collection of data about a situation; completely generally, we can assume that these data come as a set of p values, {x1 , x2 , xp } Usually, ... Introduction to Applications and Methods 1.2 Transformation and Data Representation Many different transforms are used in data processing, – Haar, Radon, Hadamard, etc The Fourier transform is perhaps the...
- 303
- 367
- 0
Enhancement of spatial data analysis
... of data, spatial geographic data and general spatial data 1.2 Spatial Geographic Data Spatial geographic data, sometimes abbreviated as geo-spatial data, distinguish themselves from general data ... whole dataset may be partitioned and allocated into different sites For instance, every site contains all data but with a fraction of attributes, i.e., a particular view/subspace of the original data ... chapter with a summary 2.1.1 Geo-Spatial Data Characteristics Geo-spatial data often exhibit two unique characteristics: spatial trend and spatial dependence [20] Spatial trend denotes the large...
- 145
- 293
- 0
The incremental value of qualitative fundamental analysis to quantitative fundamental analysis
... computer-driven (quantitative) analysis Hereinafter, quantitative fundamental analysis refers to the evaluation of a security through machine analysis of a company's financial statements and other disclosure, ... separate study of the two disciplines (in particular, the separate study of qualitative fundamental analysis) is complicated by institutional features The marriage of quantitative and qualitative ... readily available analyst data to researchers is sell-side analyst data, their potential access to inside information is a significant barrier to empirical investigations of traditional qualitative...
- 104
- 287
- 0
john a rice mathematical statistics and data analysis, second edition 1994
... chapter, theoretical results are balanced by more qualitative data analytic procedures based on analysis of residuals Chapter 15 is an introduction to decision theory and the Bayesian approach ... prktice of statistics It is in the analysis of real data that one sees the roles played by both formal theory and informal data analytic methods I have organized this book around various kinds of ... that entail the use of statistical methods and have included many real examples to motivate and introduce the theory Among the advantages of such an approach are that XIV Preface theoretical...
- 671
- 509
- 0
Báo cáo y học: " Antecedents of hospital admission for deliberate self-harm from a 14-year follow-up study using data-linkage" ppsx
... Areas (SEIFA) Based on Census information, these SEIFA provide a measure of area ‘disadvantage’ and can be used to assess socio-economic conditions by geographical areas [18] Classification of ... end of the DSH spectrum Whilst hospital admissions data was of high quality, the hospital emergency data was inadequate to allow analysis with regard to either DSH or mental health presentations ... hospitalisation for mental disorder and self-harm Strengths and limitations A key strength of this study was the methodology Followup via data- linkage to administrative datasets conferred several advantages...
- 11
- 387
- 0
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor
... and analysis The collection of reactors effluents was done daily to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are ... bioreactor may be employed as an alternative of the anaerobic reactors for treating several kind of wastewater such as industrial or municipal effluents References [1] Shivayogimath CB, Ramanujam ... Habeeb, S A. , AB Aziz Bin Abdul Latiff., Zawawi Bin Daud., Zulkifli Bin Ahmad A review on granules initiation and development inside UASB Reactor and the main factors affecting granules formation...
- 8
- 408
- 0
Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt
... in America FiOS gives consumers a super-fast broadband data experience, at speeds of up to 30 megabits downstream and megabits upstream As we move forward, the bandwidth and upstream capacity of ... consumers a super-fast broadband data experience It has speed up to 30 megabits downstream and megabits upstream As we move forward, the bandwidth and upstream capacity of the fiber system will allow ... generating realtime ratings data is unprecedented Ensure that the underlying signal area data is accurate Local broadcasters must be able to easily communicate changes in their signal area They...
- 99
- 514
- 0
Tài liệu A Comparison of Approaches to Large-Scale Data Analysis pdf
... conducted, both parallel database systems displayed a significant performance advantage over Hadoop MR in executing a variety of data intensive analysis benchmarks Averaged across all five tasks at 100 nodes, ... data) have approximately constant performance for this task, since each node has the same amount of Document data to process and this amount of data remains constant (7GB) as more nodes are added ... phase on each node in parallel, the data was actually loaded on each node sequentially Thus, as the total of amount of data is increased, the load times also increased proportionately This also...
- 14
- 923
- 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... the actual constraints exerted by the structure of a balance sheet are still limited, a qualitative survey may actually offer a stronger appraisal of their actual behaviors Section two of the paper ... analysis of the level of real wages as of wage arrears 16 Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey Micro-economic analysis (Alfandari ... intra-group variance, and maximize inter-group variance The main characters of each group are summed -up in Table 1, which reflects the average answers provided by enterprises in each sub-group Table...
- 30
- 635
- 0
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
... not always achievable due to many practical limitations, we need to consider a new method that can be applicable to time-series experimental data without parameter perturbations and that can make ... kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic cells [20,21] The budding yeast (S cerevisiae) has several MAPK cascades ... intervals at xi as a fully excited information set at xi (Definition in Supplementary material, Supplementary mathematical descriptions) and in this case we simply say that the experimental data set...
- 10
- 375
- 0
Báo cáo khoa học: "A Wiki-style Platform for Creation of Parallel Data" doc
... language As the quality of automatic translations are rarely close to human quality translations, the user may need to correct any such automatically translated or transliterated content, and an ... machine translation and transliteration systems for rough initial translation [or transliteration] of a source language string at sentential/phrasal levels [or names] to the intended target language ... WikiBABEL portal Such set of articles is already available as Featured Articles in most Wikipedias English Wikipedia has a set of ~1500 articles that are voted by the community as stable and well...
- 4
- 224
- 0
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, albumin levels and prothrombin time), fasting ... The starting point for survival analysis was date of diagnosis of NAFLD Patient follow -up was extended up to April 2008 The end-points for survival analysis were death or liver transplantation ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table...
- 7
- 487
- 0
Báo cáo " Calibration and verification of a hydrological model using event data " ppt
... table 2.2 Table 2.1 NAM parameter explanation and boundaries NAM Parameter NAM Parameter Description Unit Umax Lmax CQOF CKIF CK1,2 TOF TIF TG CKBF Maximum water content in surface storage Maximum ... measurable quantities of basin characteristics [6] and hence model calibration is needed Using the observed rainfall and evaporation data of each storm event as inputs, model will automatically ... verification procedure introduced above, Gia Vong – a river basin in Quang Tri was taken as a case study (Figure 3.1) The basin has an area of about 275 km2, a perimeter of 111.9 km and an average...
- 11
- 440
- 0
Carbon credit supply potential beyond 2012: A bottom-up assessment of mitigation options docx
... Mexico Bahrain Thailand Colombia Kazakhstan Indonesia Iran Kazakhstan Pakistan Thailand Indonesia Kazakhstan Indonesia South Korea Egypt Argentina Thailand Iran Venezuela Macedonia Iran Chile Source: ... against the MAC curves The quantification of the abatement potential that pCDM can facilitate and thereby provide additional supply of CERs will be based on the updated TETRIS database of GHG abatement ... potential data from the updated TETRIS database A systematic search of the various mitigation options covered by the abovementioned methodologies was performed within the database and potentials of...
- 108
- 270
- 1
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
báo cáo sinh học:" Call for manuscripts: "Towards a scaling-up of training and education for health workers" ppt
... from, and complement, traditional community health worker training? • How can the health professional training be better aligned with local health needs and be more socially accountable? • What ... is the status of existing collaborations between developing countries aiming to improve health worker education? • How have modifications in healthcare management had an impact upon health workforce ... lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited...
- 2
- 415
- 0
báo cáo sinh học:" Final call for papers: "Towards a scaling-up of training and education for health workers" potx
... principally from inadequate educational opportunities for health workers and a lack of relevance of their training to community health care practice Additional contributing factors include: inadequate ... modifications in healthcare management had an impact upon health workforce capacity at the local level? Papers will be accepted in two formats: Brief communications of less than 1200 words: better ... mix to local health service needs? For example, what impact have recent health sector reforms had on the local health workforce? • What is the status of existing efforts to train health workers...
- 2
- 370
- 0
báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx
... selected based on a "snowballing" process originating from an in-country advisory panel, made up of academics, representatives of nongovernmental organizations, a Zambian clinician and a representative ... year to year There may also be a negative impact on long-term quality of care if top-ups are withdrawn after a year, and this underlines concerns about sustainability of the programmes An advisor ... and changing area The research for this paper was conducted as part of a "twinning" project between a Zambian researcher and a UK researcher Ethical clearance for the research was granted by the...
- 9
- 594
- 0
báo cáo hóa học: " Co-morbidity and visual acuity are risk factors for health-related quality of life decline: five-month follow-up EQ-5D data of visually impaired older patients" ppt
... age-related cataract and age-related macular degeneration (AMD) Due to demographic aging, these numbers are expected to increase and this group of patients will cause an increased demand for ophthalmic ... statistical analyses; MRDB participated in the design of the study, collected data, advised on the statistical analyses, and helped to interpret the data; JGJH drafted a preliminary version of the manuscript ... (data not shown) Patient characteristics Table presents the baseline characteristics of the patients Of the visually impaired population, in more than 50% the primary cause of vision loss was...
- 9
- 420
- 0
Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt
... DNA polymerase II (PolII), bacterial DNA polymerase III α subunit (DnaE) and bacteriophage DNA polymerase I Among these, archaeal PolI belongs to the family B DNA polymerase Archaeal PolI contains ... KFVKPVSLEFEKVYYPYLLI -AEAMALGREAADWVSG HFPSPIRLEFEKVYFPYLLI -MKTIAKCQRAAKLINQ NVPKPQSIVYEKTLHPFILV - : : :: Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains ... Matsui H, Nakamura M, Aminov RI: Phylogenetic analysis of archaeal 16S rRNA libraries from the rumen suggests the existence of a novel group of archaea not associated with known methanogens FEMS...
- 7
- 435
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose