evidence from a natural experiment
Working PaPer SerieS no 1272 / DeCeMBer 2010: THe iMPaCT of PuBliC guaranTeeS on Bank riSk Taking eviDenCe froM a naTural exPeriMenT pptx
Ngày tải lên :
15/03/2014, 10:20
... savings bank is a liated with one federal state bank (“Landesbank”) and each federal state bank is a liated with a state (“Bundesland”) or group of states The a liated savings banks own each a ... deviation of the average return of assets, E stands for equity, and A for total assets.22 The latter two are used to calculate the capital assets ratio (E /A = CAR) ROAA and CAR are both averages ... characteristics, we also use annual balance sheets for the 452 savings banks The savings bank data is also from the German Savings Banks Association By using this proprietary data set, the sample...
- 53
- 1.4K
- 0
Savings Constraints and Microenterprise Development: Evidence from a Field Experiment in Kenya∗ ppt
Ngày tải lên :
06/03/2014, 10:20
... Rural Banks Matter? Evidence from the Indian Social Banking Experiment. ” American Economic Review 95 (3): 780-795 [12] Chaia, Alberto, Aparna Dalal, Tony Goland, Maria Jose Gonzalez, Jonathan ... (Chaia et al., 2009; Kendall et al., 2010) With regards to Africa more specifically, Aggarwal et al (2011) use the Gallup World Poll to show that only 15% of people in Sub-Saharan Africa have a ... Dupas, Pascaline, and Jonathan Robinson (2012).“Why don’t the Poor Save More? Evidence from Health Savings Experiments in Kenya” Mimeo, UCLA [25] Dupas, Pascaline, Sarah Green, Anthony Keats, and...
- 38
- 681
- 0
Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt
Ngày tải lên :
13/08/2014, 11:22
... of Australia; 2002 ABS: Australian Bureau of Statistics (ABS) National Health Survey 2004– 05: Summary of Results (Catalogue No 4364.0) Canberra: Commonwealth of Australia; 2006 ABS: Australian ... Understanding Statistics 2002, 1:223-31 ABS: Australian Bureau of Statistics (ABS) Population by Age and Sex Australian States and Territories (Catalogue No 3201.0) Canberra: Commonwealth of Australia; ... Lives saved Medical(B – A) Cure(B – A) AgeGrp_(B – A) † AgeGrp1(B – A) † AgeGrp2(B – A) † AgeGrp4(B – A) † Evidence( B – A) Fault(B – A) $Private(B – A) ^ Effect(B – A) ‡ $Cost(B – A) ^ HlthCard*Q SIEFA_Econ*Q/1000...
- 15
- 363
- 0
Credit channel, trade credit channel, and inventory investment: evidence from a panel of UK firms pot
Ngày tải lên :
06/03/2014, 08:20
... firm-years rather than simply firms See Carpenter and Guariglia (2003), Bond and Meghir (1994), Kaplan and Zingales (1997), Guariglia and Schiantarelli (1998), and Guariglia (2000) for a similar approach ... channel actually weakens the traditional credit channel (see De Blasio, 2003, for a similar approach) As financially constrained firm- years are more likely to be affected by financial variables ... equation with a coverage ratio variable and a trade credit to assets variable, and we have estimated it differentiating the effects of the latter two variables for small and large firm- years...
- 32
- 443
- 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
Ngày tải lên :
06/03/2014, 08:20
... of a balance sheet are still limited, a qualitative survey may actually offer a stronger appraisal of their actual behaviors Section two of the paper presents a brief description of the data base ... analysis (Alfandari & Schaffer, 1996; Lehmann and al, 1998) and anecdotal evidence suggest indeed that delays in the payment of wages has been a dominant form of labor market adjustment in Russia 11 ... quarterly basis by the Russian Academy of Science Questions are mainly of a qualitative nature, with a number of possible answers ranging from two to ten, as their scope takes a more cardinal nature...
- 30
- 635
- 0
THE EFFECTS OF MEGAMERGERS ON EFFICIENCY AND PRICES: EVIDENCE FROM A BANK PROFIT FUNCTION docx
Ngày tải lên :
06/03/2014, 08:21
... significant, given that EFF1 and EFF2 both appear twice in the three main variables and W2 appears in all three main variables (recall that W1 s - W2) and is also represent~ a fourth time as a stand-alone ... 27Thus, ROAa = NIa/TA and ROEa = N~/EQ, where NIa is net income plus taxes and provisions, TA = total assets and EQ = equity capital The average ROAa (ROEa) level for merging banks was 1.4% (22%) ... between banks that have significant local market overlap ex ante may increase local market concentration and market share and allow the consolidated banks to raise profits by setting prices less favorable...
- 66
- 470
- 1
TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot
Ngày tải lên :
06/03/2014, 10:20
... savings balance (hundreds) Active account Barangay’s distance to branch Bank’s penetration in barangay Standard deviation of balances in barangay (hundreds) Mean savings balance in barangay (hundreds) ... TABLE II SUMMARY STATISTICS OF VARIABLES, BY TREATMENT ASSIGNMENT MEANS AND STANDARD ERRORS F-stat Control Marketing Treatment P-value A VARIABLES AVAILABLE AT TIME OF RANDOMIZATION Client savings ... visit from the Bank “Active” (row 2) defined as having had a transaction in their account in the past six months Mean balances of savings accounts include empty accounts Barangays are the smallest...
- 38
- 523
- 0
The Impact of Low Income on Child Health: Evidence from a Birth Cohort Study pptx
Ngày tải lên :
22/03/2014, 09:20
... Wealthier parents may have more advantaged children because they have more income to buy health care or because parental wealth is associated with beneficial behaviours or because parental health ... But we can use this data as a check on the financial hardship based low-income measures Information is available on both financial hardship and family income when the children are aged 33 and 85 ... indicator in the main analysis 32 Table A5 : Sample participation at 81 months as a function of poor child health at six months and low-income at eight months Sample participation at 81 months Marginal...
- 37
- 522
- 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx
Ngày tải lên :
22/03/2014, 23:20
... empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence from the labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International ... quality of banking and regional growth Hasan, Koetter, Wedow 11 2007 Welfare effects of financial integration Fecht, Grüner, Hartmann 12 2007 The marketability of bank assets and managerial Falko ... risk-return-characteristics – evidence from loan portfolios of German banks A Behr, A Kamp C Memmel, A Pfingsten 05 2007 06 2007 How banks adjust their capital ratios? Evidence from Germany Christoph...
- 40
- 468
- 0
Parental Education and Child Health: Evidence from a Schooling Reform pot
Ngày tải lên :
28/03/2014, 09:20
... that parental education may affect child health indirectly via parental behavior, parental health and parental financial resources By investigating the causal impact of education on these parental ... health, parental education and child health can also be related in non-causal ways Indeed, endowments that are transmitted across generations can cause a positive association between parental education ... of parental education on a wide range of child health variables These variables include health measured at birth as well as health measured later in childhood We discussed above that parental...
- 31
- 369
- 0
báo cáo sinh học:" Training needs assessment for clinicians at antiretroviral therapy clinics: evidence from a national survey in Uganda" docx
Ngày tải lên :
18/06/2014, 17:20
... Evelyn Eleku, Nankinga Ziadah, Leah Wanyenya, Albert Majwala and Grace Nakate We are indebted to the district health teams and all the health professionals and patients in the health facilities included ... comprising a social scientist, medical doctor and field assistant A team spent one day at each facility and collected data from an average of 11 facilities during a twoweek period in July and August ... six areas were selected: Arua, Lira, Masaka, Hoima, Kabale and Mbale Using proportionate allocation to size sampling method, a sample 44 of the 205 accredited facilities as of July 2006 was selected...
- 8
- 358
- 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot
Ngày tải lên :
20/06/2014, 15:20
... was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after technical training school, the second level training after BMT, and before a participant's ... self-rated general health and important medical endpoints [1,5,6] Given its brevity and apparent validity as a marker for health and health behaviors, self-rated health may prove to be a useful ... effects reaching statistical significance In summary, a single-item self-assessment of health was consistently related to a variety of health parameters important to the military Used at a population...
- 9
- 301
- 0
liu and liu - 2008 - auditor switching, earnings manipulation and auditor independence - evidence from a-share listed companies in china
Ngày tải lên :
06/01/2015, 19:43
... earnings manipulation and auditor independence 291 A- share listed companies from 1999-2004 as initial samples All data used in the present article were from China Stock Market Financial Database ... the switch ASC NASC (p-value) ASC NASC (p-value) ASC NASC (p-value) Year of the switch Discretionary accruals changes before and after the switch Discretionary accruals (DA1) Means Medians –0.012 ... clients’ earnings manipulation(Zhang and Liu, 2002; Li et al., 2004) The reason is that auditors have an incentive to protect themselves against potential damages arising from clients’ earnings manipulation...
- 20
- 331
- 0
Enforceability of Labor Law: Evidence from a Labor Court in Mexico
Ngày tải lên :
23/04/2016, 05:11
... which a worker with more than seven years of tenure was awarded a positive amount at trial In all seven of these cases the award was collected It is clear that, at least in the case of public lawyers ... Settlement Delay, and Low-Quality Litigation: Empirical Evidence from Two Datasets, Journal of Law, Economics, and Organization 19(2):517-542 [13] Kaplan, David S., Gabriel Martínez González, and Raymond ... is a component of the total time to enforce a contract, was provided to us by the Doing Business staff and are available upon request strategy and equilibria In this area, Helland and Tabbarrock...
- 36
- 277
- 0
Technology, Computers and Wages: Evidence from a Developing Economy
Ngày tải lên :
25/04/2016, 08:14
... and Kramarz 1998 Entorf, Gollac and Kramarz 1999 Asplund 1997 United States United States United States United States Australia Australia Canada Canada France France France Finland Dinardo and ... Hirschberg and J Lye 1999 “Computer Knowledge and Earnings: 19 Evidence for Australia.” Australian National University (mimeo) Bresnahan, T.F 1999 "Computerisation and Wage Dispersion: An Analytical ... Pischke 1997 Haisken-DeNew and Schmidt 1999 Oosterbeek 1997 Arabsheibani, Emami and Marin 1996 Arabsheibani and Marin 2000 Bell 1996 Green 1998 Borghans and Ter Weel 200 0a Sakellariou and Patrinos...
- 24
- 357
- 0
Tài liệu Báo cáo khoa học: Cleavage of nonphenolic b-1 diarylpropane lignin model dimers by manganese peroxidase from Phanerochaete chrysosporium Evidence for a hydrogen abstraction mechanism docx
Ngày tải lên :
20/02/2014, 23:20
... prepared for analysis as described above Chromatography and mass spectrometry GC-MS was performed at 70 eV on a Finnigan 4500 mass spectrometer using a Galaxy data system and fitted with a Hewlett ... abstraction from the aromatic ring We also show that a- keto diarylpropane lignin dimeric compounds are degraded by a hydrogen abstraction mechanism to produce benzoic acid derivatives Materials ... diarylpropane (IV) can be explained on the basis of an initial hydrogen abstraction reaction at one of two positions A benzylic radical can be generated at C1, which is resonance stabilized by aromatic...
- 9
- 496
- 1
Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc
Ngày tải lên :
21/02/2014, 20:20
... "What is the average of the salaries of the part-time employees?" One cannot slmply average over a set of salaries, since several employees may have the same salary; an indexed set ensures that ... Pereira L M and Perelra F C N Prolog - the language and its implementation compared with Lisp ACM Symposium on AI and Programming Languages, Rochester, New York, Aug 1977, pp 109-115 natural language ... correct, and that is compatible with efficient database access? The main drawback of this approach is that it leaves open the question of how predicates applied to sets relate to those same predicates...
- 4
- 445
- 0
Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx
Ngày tải lên :
22/02/2014, 04:20
... Pkg2.sg, Pkg2 from Streptomyces granaticolor [9]; PpkA.pa, PpkA from P aeruginosa [31]; PknA.ana, PknA from Anabaena [7]; YpkA.yp, YpkA from Y pseudotuberculosis [10] [c-32P]ATP and either histone ... Biolabs After PCR amplification, pknA was treated with Klenow, and the blunt-ended fragment was cloned at the SmaI site of pUC19 (pPknA) Plasmid DNA was prepared after transformation of pPknA in ... an additional 20 s in each cycle) PCR was also used to generate the K42N (replacement of lysine by asparagine at residue 42) point mutant of PknA Two forward primers, CC58 (5¢-CACAGGAATTCCATA...
- 8
- 428
- 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
Ngày tải lên :
16/03/2014, 00:20
... 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse) The pET151 HP1287 plasmid was amplified using PfuTurbo DNA polymerase and incubated with DpnI to digest the template plasmid Mutated ... QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...
- 9
- 491
- 0
