evaluation of a combined treatment with iron sucrose and erythropoietin alpha predictors of response efficacy and safety
Báo cáo y học: "The effect of combined treatment with morphine sulphate and low-dose ketamine in a prehospital setting" doc
... recorded Statistics The results are presented as mean, standard deviations (SD), median and quartiles Demographic data were analysed using parametric t-test Pain and nausea scores were analysed using ... NRS-scores of for pain, with a SD of 0.75, reaches a power-value of 0.8 with patients included in each group against a p-value of 5% P < 0.05 is considered statistically significant [9] Data analysis and ... contributions PJ made substantial contribution to conception and design to the study PK participated in data analysis and interpretation AJ made statistical analysis and substantial contribution...
- 5
- 303
- 0
Báo cáo khoa học: " RadioImmunotherapy for adenoid cystic carcinoma: a single-institution series of combined treatment with cetuximab" docx
... EK, Ang KK: Radiotherapy plus cetuximab for locoregionally advanced head and neck cancer: 5-year survival data from a phase randomised trial, and relation between cetuximab-induced rash and survival ... Maxilla pt tuba auditiva tumour stage pts base of skull Analysis Treatment response was analysed wks post completion of RIT (first follow-up) and at each available follow-up (best response) according ... safety margin along typical pathways of spread (if possible safety margin of about cm) depending on the anatomical relationship of adjacent structures In particular, neurovascular sheaths and locoregional...
- 8
- 339
- 0
báo cáo hóa học:" Effect of combined treatment with alendronate and calcitriol on femoral neck strength in osteopenic rats" doc
... of combined treatment with alendronate and alpha- hydroxyvitamin D3 on bone loss by ovariectomy in aged rats Jpn J Pharmacol 2002, 89:255-66 Kabasawa Y, Asahina I, Gunji A, Omura K: Administration ... Shiraishi A, Takeda S, Masaki T, Higuchi Y, Uchiyama Y, Kubodera N, Sato K, Ikeda K, Nakamura T, Matsumoto T, Ogata E: Alfacalcidol inhibits bone resorption and stimulates formation in an ovariectomized ... and total bone area, which are all correlated with femoral neck strength Among the three parameters in bone mass, total BMC and cortical BMC were increased by alendronate, and total bone area...
- 10
- 431
- 1
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f1 R is an integral domain Let S be the subring of R generated ... Bhargava, The density of discriminants of quartic rings and fields, Ann of Math 162 (2005), 1031–1063 [3] ——— , The density of of discriminants of quintic rings and fields, Ann of Math., to appear ... Annals of Mathematics, 163 (2006), 723–741 The number of extensions of a number field with fixed degree and bounded discriminant By Jordan S Ellenberg and Akshay Venkatesh* Abstract We give an...
- 20
- 478
- 0
Báo cáo hóa học: "Early combined treatment with sildenafil and adipose-derived mesenchymal stem cells preserves heart function in rat dilated cardiomyopathy" doc
... Ikeda T, Sakata R: Prolonged mechanical unloading preserves myocardial contractility but impairs relaxation in rat heart of dilated cardiomyopathy accompanied by myocardial stiffness and apoptosis ... 106 ADMSC implanted into LV anterior wall), group (sildenafil 30 mg/kg/day, orally), and group (combined sildenafil and ADMSC) ADMSC transplantation and oral sildenafil were given on day after ... (ADMSC therapy) and (sildenafil therapy) than in groups (normal control) and (combined ADMSC and sildenafil therapy) but it did not differ between groups and (Table 2) Statistical Analysis Data...
- 16
- 495
- 0
Báo cáo hóa học: " Bi-Functional Silica Nanoparticles Doped with Iron Oxide and CdTe Prepared by a Facile Method" doc
... superparamagnetic This was because the size of the iron oxide nanoparticles which was used to prepare the FSCS nanoparticles was about 10 nm [30] The saturation magnetization (Ms) value of the final ... together and stirred for 12 h The final product was isolated by centrifugation and it was denoted as FSC nanoparticles The prepared FSC nanoparticles were further coated with an outer silica layer After ... Jun, D.J Zaziski, E.M Chan, A Corrias, A. P Alivisatos, J Am Chem Soc 128, 1675 (2006) doi:10.1021/ ja056139x 25 J Giri, S Guha Thakurta, J Bellare, A Kumar Nigam, D Bahadur, J Magn Magn Mater 293,...
- 6
- 240
- 0
Báo cáo khoa học: " Combined treatment with lexatumumab and irradiation leads to strongly increased long term tumour control under normoxic and hypoxic conditions" potx
... high efficacy of a combined treatment with another proapoptotic antibody (mapatumumab, anti-DR4) and irradiation Both models are in line with in vitro data from our and other labs demonstrating ... Verweij J: Mapatumumab, a fully human agonistic monoclonal antibody that targets TRAIL-R1, in combination with gemcitabine and cisplatin: A phase 1b study in patients with advanced solid malignancies ... after treatment with lexatumumab In addition, we like to thank Katrin Stasch and Stefan Ablasser for technical assistance This work was supported by a grant from the Federal Ministry of Education...
- 8
- 419
- 0
Báo cáo sinh học: "Inequality of maximum a posteriori estimators with equivalent sire and animal models for threshold traits" pps
... the state of the art for genetic evaluation of breeding animals Basically, all the practical and theoretical reasons in favour of the use of an animal model instead of a sire model for traits ... thereafter Hypothetical data set a heritability value of about 0.81 and decreases rapidly by Gianola and Foulley Table II shows the maximum a posteriori estimates of the parameters of the data set ... that the marginal expected value E[alM is: o] a Q Using the additive-genetic transmission model, where p is a progeny of sire s and dam d, and a is a random variable with mean and variance u’12...
- 13
- 302
- 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... pre- and post-raltegravir viral load measurements was done Viral load values at Day 0, Day and Day 10 were compared with viral loads at 27 and 166 days prior to treatment start Significant differences ... Animals, as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107...
- 19
- 317
- 0
Báo cáo sinh học: "Genetic evaluation for a quantitative trait controlled by polygenes and a major locus with genotypes not or only partly known" doc
... inbred and in Hardy-Weinberg and gametic equilibria In the base population the possible genotypes at the major locus (AA, Aa and aa), which will be denoted as 1, and throughout this paper, are therefore ... the base population (animals with unknown parents) in Hardy-Weinberg equilibrium, Pr(Tlp) can be written as: where n n and n are the number of base animals of genotype AA, Aa and aa, , l l b respectively, ... notation as: et al (1993) assumed that Var (a ) * Var (a) A - Q and Var(e ) = * a I - Q The matrices Q and W are not known and have be estimated Var(e) e from the data as described above Therefore, the...
- 19
- 236
- 0
seryozha a russian reader with explanatory notes and vocabulary
... themselves with works of classical Russian and Soviet literature in the original The story Seryozha, written by the well-known Soviet author Vera Panova, is extremely popular with Soviet readers, and ... and it has come out in numerous translations abroad The story is notable for its author's profound understanding of a child's psychology and her deep insight into his shaping consciousness and his ... the readers, the more difficult turns of phrase are translated or explained in the Notes (they are marked with an asterisk in the text) The book is complete with a RussianEnglish Vocabulary, which...
- 237
- 412
- 0
the situation of diabetes, pre-diabetes to the khmer in hau giang province and an evaluation of the efficacy of some interventional methods
... can be prevented and managed to have treatment, if it is consulted and treated early Moreover, a balance diet and proper exercises can help reduce the risk of prevalence and complication In Hau ... diabetes treatment at medical station At the same time, having a combination with Khmer clinic staff, mass organization and religious authorities in the local area to organize prevention work of ... includes Impaired Fasting Glucose – IFG and Impaired Glucose Tolerance – IGT” 1.1.2 Diagnosis and classification of diabetes 1.1.2.1 Diagnosis of diabetes: Standards for diagnosis of diabetes and blood...
- 28
- 464
- 0
Báo cáo khoa học: "A hermaphrodite dog with bilateral ovotestes and pyometra" doc
... tnemegnarra tcapmoc a saw erehT setsetovo gnieb ,ralimis saw sdanog htob fo ygolotsih ehT noitanimaxe lacigolohtapotsih rof nisoe dna nilyxotameh htiw deniats dna edam erew snoitces mµ ruoF niffarap ... serutaef lacigolohtapocinilC ebut eniretu a dna ,eairbmif ,suxelp mrofinipmap a ,selubut tnereffe dah danog hcaE danog hcae ot tnecajda dnuof erew simydidipe depoleved yletelpmocni dna eussit latcudivO ... ro ladanog ,lamosomorhc eht ,tnempoleved lauxes ni pets yna ta tcefed a morf esira nac tnempoleved lauxes ni seitilamronbA ymotceretsyhoiravo na gniwollof yrevocer etelpmoc a edam hctib ehT artemoyp...
- 2
- 265
- 0
Báo cáo khoa học: "Radiosurgery for pituitary adenomas: evaluation of its efficacy and safety" ppsx
... clinical, laboratorial and radiological evaluation were performed Clinical evaluation consisted of neurological examination and a comprehensive ophthalmological evaluation including visual field ... by visual field and acuity examinations The follow-up schedule included clinical examinations with ophthalmological and endocrinological evaluations and MRI of the brain and sellar region at 6-month ... the management of selected patients with pituitary adenomas The short latency of the radiation response, the highly acceptable radiological and hormonal control and absence of complications at...
- 6
- 277
- 0
Báo cáo y học: "Benign gastro-colic fistula in a woman presenting with weight loss and intermittent vomiting: a case report" pps
... vomiting, diarrhea and approximately 20 kilogram weight loss She denied any hematemesis, melena or fever At presentation our patient was frail and emaciated Regarding clinical examination, there ... medication On this occasion, gastroscopy revealed a deep ulcer of the greater curve of the stomach that appeared to penetrate the muscular layer and was highly suspicious of a fistula The pathological ... pathological report of the performed biopsy Page of showed chronic inflammatory changes An abdominal CT demonstrated a fistula between the stomach and transverse colon and excluded malignant disease...
- 3
- 363
- 0
Báo cáo y học: " Poly-substance use and antisocial personality traits at admission predict cumulative retention in a buprenorphine programme with mandatory work and high compliance profile" ppt
... was translated and backtranslated into English, and standardized on a nationally representative sample of 5,000 community residents and validated against psychiatric samples with relevant diagnoses ... 22(1):1-10 17 The National Board of Health and Welfare: Swedish National Guidelines for Treatment of Substance Abuse and Dependence Stockholm The National Board of Health and Welfare; 2007 18 SOSFS ... diagnoses and substance abusers (total n = 1,800) On the basis of the representative sample gender-adjusted Tscores have been developed T-scores have a normal mean of 50 and a standard deviation of...
- 8
- 364
- 0
and but or as cohesive devices in english written discouse - a contrastive analysis with vietnamese equivalents and implications for teaching writing skill at utehy
... Halliday and Hasan (1979) that A text has textual and this is what distinguishes it from something that is not a text.” And the primary determinant that create textual is cohesive relations within ... ellipsis and structural parallelism In 1976, with the book Cohesion in English, Halliday and Hasan say that the concept of cohesion accounts for the essential semantic relations whereby any passage of ... importance of the English language in the present time as a global language because it has become more dominant around the world than any other languages It is used as an official language in...
- 45
- 610
- 1
A SPECIALLY COMMISSIONED REPORT NAVIGATING HEALTH AND SAFETY LAW pot
... years experience in health and safety and over 30 years in the construction industry He also has a role locally and regionally in other health and safety associations He manages a small training ... PROFESSIONAL INSIGHTS 38 N AV I G AT I N G H E A LT H A N D S A F E T Y L AW Landlords Landlords have fire, gas and electrical safety and other general duties to discharge A safety policy may ... standards In the UK compliance with a relevant British Standard at one time meant that the product had been tested and found to reliably achieve an appropriate level of safety in use In many cases...
- 125
- 335
- 0
báo cáo hóa học:" Psychometric evaluation of the Osteoporosis Patient Treatment Satisfaction Questionnaire (OPSAT-Q™), a novel measure to assess satisfaction with bisphosphonate treatment in postmenopausal women" potx
... patient adherence to treatment regimens Treatment satisfaction is an increasingly important component of assessing overall quality of health care services and treatments, and satisfaction-related ... Rowland CR: Validation of a general measure of treatment satisfaction, the Treatment Satisfaction Questionnaire for Medication (TSQM), using a national panel study of chronic disease Health Qual ... Authors' contributions 10 EF drafted the manuscript and participated in the design, data collection, and data analysis KB helped draft the manuscript and participated in the design and data analysis...
- 9
- 629
- 0
Báo cáo khoa học: " Intraoperative radiotherapy (IORT) combined with external beam radiotherapy (EBRT) for soft-tissue sarcomas – a retrospective evaluation of the Homburg experience in the years 1995–2007" pdf
... literature data, having achieved a local control rate of 63%/5 years and an overall survival of 57%/5 years with a late complication rate of 42% comprising delayed wound healing and late skin reactions, ... LE, Adhan M, Romestaing P, Chapet O, Isaac S, Gerard JP: Surgical management of retroperitoneal sarcomas associated with external and intraoperative radiotherapy European journal of surgical oncology ... intraoperative brachytherapy in soft tissue sarcomas involving neurovascular structure Radiotherapy and oncology 2006, 78:10-16 Abe M, Takahashi M, Yabumoto E: Intraoperative radiotherapy of advanced...
- 6
- 334
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose