... Ensembl protein identifiers of our dataset of human proteins This gave a dataset of 3,839 proteins, each of which has an associated experimentally determined mRNA decay rate We separated our 3,839 protein ... Protein disorder, mRNA decay rates andprotein stability indices We examined trends between mRNA decay rates and amounts ofdisordered residues, and between protein halflives and frequency ofdisordered ... back-propagation network trained to recognize features of ubiquitin targeting signals over a sliding window of 21 amino acids in the target sequence The network was trained using a balanced dataset of...
... since each carbon nanotube is atomic in size, but the carbon nanotube lattice would be stronger than any ordinary material So, via a combination of plasma window, laser curtain, and carbon nanotube ... instincts but no formal training whatsoever, Maxwell, a contemporary of Faraday, was a master of advanced mathematics He excelled as a student of mathematical physics at Cambridge, where Isaac ... further in the next chapter And behind this laser curtain one might envision a lattice made of "carbon nanotubes," tiny tubes made of individual carbon atoms that are one atom thick and that are many...
... Roskams, T & Brechot, C (1999) Hepatocarcinoma-intestine-pancreas/pancreatic associated protein (HIP/PAP) is expressed and secreted by proliferating ductules as well as by hepatocarcinoma and ... colocalization of HIP/PAP with RIIa Staining was analyzed by confocal laser scanning microscopy Image is an optical section of 0.3 lm along the z-axis PKA activity in Chang cells expressing HIP/PAP ... HIP/PAP is a substrate for PKA (A) Recombinant HIP/PAP was incubated for 30 at 30 °C with the catalytic subunit of PKA and 100 lM [32P]ATP[cP] in 80 lL as described in the Materials and methods Aliquots...
... arbitrary shapes that can match the true pattern of the measured antenna array This can increase the accuracy in the estimate of C compared to only assuming an omnidirectional element factor that ... as a jointly unknown parameter during the estimationof the coupling matrix, C This requires a parametrization that provides a flexible and mathematically appealing representation of an a priori ... element is DATA MODEL AND PROBLEM FORMULATION Consider a uniform linear antenna array with M elements having an interelement spacing of d A narrowband signal, s(t), is emitted bya point source...
... non-essential amino acids stimulated blastocyst formation According to Liu and Foote [14] nonessential amino acids (NEAA) have a stimulatory effect upon all developmental stages, and essential amino acids ... Lee, E S and Fukui Y Synergistic effect of alanine and glycine on bovine embryos cultured ina chemically defined medium and amino acid uptake byin vitro produced bovine morulae and blastocysts ... in 2-3 ㎕ of medium, and 15 ㎕ of Hoechst 33342 stain prepared with sodium citrate (2.3%) and ethyl alcohol was added The slide was then incubated on a warming plate for min, the extra stain was...
... Barker JE(1982) Effect of pollination period and strobili number on random mating ina clonal seed orchard of Picea mariana Silvae Genet 31, 90-94 Reynolds S, El-Kassaby YA (1990) Parental balance ... elevations between and 415 m on western Vancouver Island, Washington and Oregon The orchard was established in 1971 ina random single-tree mix over unequal blocks Trees are spaced m apart and ... and El-Kassaby (1990) used cumulative seedcrop data to assess parental balance ina Douglas fir seed orchard, and found the cumulative seed-yield curve is a better parameter than cone-yield in...
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... The amount of sGAG remaining within the cartilage explant after 24 hours of treatment with TNF-α and C2-ceramide in the presence and absence of 2-AP was determined by papain digestion and DMMB assay ... penicillin and 10 µg/ml streptomycin In vitro cartilage samples Cartilage was taken from the metacarpophalangeal joint of 7-day-old bovine calves within 12 hours of slaughter using a scalpel and...
... concentration of APP in samples of CSF was calculated from the linear part ofa standard curve In contrast to other analyses, only 86 SLE patients were analyzed regarding APP A sandwich ELISA (Amersham ... All these biochemical indices are indirect measures of brain inflammation In contrast to a multitude of studies analyzing local inflammatory response in NPSLE, the evaluation of neuronal damage ... mechanisms of neuropsychiatric manifestations are still the subject of intense investigations, but autoantibody and cytokine-mediated neural dysfunction, intracranial angiopathy and coagulopathy have all...
... demonstrate that apoptosis induced by agarose is a component of total DNA breakage, and that the inhibition of apoptosis allows for more proper estimationof radiation-induced DNA DSB repair and apoptosis ... caspase-3 activation in irradiated cells growing as a monolayer, and caspase-3 activation was seen only in cells embedded in agarose (whether irradiated or not), allows us to rule out a radiation-induced ... apoptosis after 45 Gy (of 174 cells evaluated, were caspase positive after hours of incubation time: 3.44% of cell population), a finding that also precludes a substantial radiationinduced origin of apoptosis...
... Brazil 2Instituto Coração Hospital das Clínicas da Faculdade de Medicina da USP (InCor HC-FMUSP), São Paulo, Brazil 3Hospital Ana Neri da Faculdade de Medicina da Universidade Federal da Bahia ... the use of alternative ways to access VC in clinical practice [30] Table Comparison with averages and Standard deviation variables: age, BMI, DVC through ventilometry and spirometry in pre and post ... pre operatory groups a great value for clinical practice, mainly when these techniques can be applied ina practical way, in bed and at low cost In literature there is an array of researches highlighting...
... located in villages Nanakpur, Marranwala and Bassolan of Tehsil Kalka, District Panchkula in Haryana state of North India for allowing data collection Thanks are also due to the subjects who have ... Marranwala and Bassolan The participants were taken from a mixed population of the area i.e belonging to caste groups Lobana, Saini, Gujjar, Kumhar, Teli, Nai, Dhiman and Lohar These are the major ... accurate estimationof stature by linear regression analysis Although the SEE value is minimal and the predictive accuracy (R2) maximum for T1, accuracy of all measurements in stature estimation...
... 5'GGGCATTTTGGGTTATGT TG3' 5'TCCCCACTCGTTGTCATA CC3' 146 bp 5'CAGCAAGGGAGGAACCAG TA3' 5'TAGCGCAAGACCATCAAC AA3' 130 bp 5'ATGAAGGCGATGAAGGAG AA3' 5'GTACGCAATGGAATGGAA CC3' 112 bp 5'GGTCTTGCTCTCCATCTG CT3' ... 5'CGGGCTGTCGTCTCATAC TT3' 114 bp 5'ACCAGCACAAATCAAAGG A3 ' 5'GCCAAAGTATGAGACGAC AGC3' 149 bp 5'GTCACTAAGCCATCGGTC GT3' 5'ACACGGACACAACCAGTT CA3' 112 bp 0.94 0.020 GE617482 *Amplification efficiency was calculated ... Brazil are B brizantha cv Marandu and B decumbens cv Basilisk [1] They show qualities of forage grass, good adaptability to cerrado areas (dry-tropical savanna, Brazil), and are cultivated in...
... committee and all patients gave written informed consent to be included in the study For the present analysis, all patients with available ACPA and IgM-RF data at baseline and after one year, and available ... correlation was Table 1: The relation between ACPA status and levels and outcome variables Correlation of ACPA levels at baseline P1 ACPA positive at baseline (n = 304) ACPA negative at baseline ... IgM-RF and ACPA compared with the absolute change of DAS28, HAQ and SHS The x-axes of a, c and f represent change in anti-citrullinated protein antibody (ACPA) levels in the first year The x-axes of...
... members of the STAT pathway, PI3K/Akt pathway and mitogen-activated protein (MAP) kinase family [10-12] MAP kinases are a family of serine/threonine kinases that are activated by phosphorylation of ... these pathways are activated by BCG alone and that opsonization of BCG with SP -A leads to enhanced activation of both pathways, contributing to increased intracellular BCG killing Materials and ... production induced by BCG and SP -A- BCG complexes Activation of intracellular protein tyrosine kinases is a common pathway involved in signalling induced bya variety of pathogens and pathogen-derived...
... the least amount of milk which was also the least rich in fat, protein, casein and serum protein contents As the ewes became older, there was an increase in fat andprotein contents and the milk ... regard, both traits had a genetic correlation near unity and very close heritability and repeatability values and were equally correlated to LILCY, indicating that proteinand casein contents are ... mean of somatic cells (in their natural logarithmic form) variance explained by the FYS factor was calculated by dividing the variance component of the FYS factor by the sum of the residual and...
... can also be observed in amoebae (Allen and Allen, 1978b), algae and terrestrial plants (Allen and Allen, 197 8a) , and animals (Niwayama et al., 2011) In plants and animals, cytoplasmic streaming ... pores degenerate over time resulting in catastrophic hyphal failure, indicating that SPA13 plays a role in maintaining septal pore integrity In summary, using a machine learning approach together ... generated by actin and myosin and plays an important role in metabolism and development For instance, streaming in the one cell embryo of C elegans is involved in the partitioning of PAR proteins...
... people at home not have a full breakfast according to traditional breakfast as well as conditional breakfast They often have cereal or porridge, egg and bacon followed by toast and marmalade and coffee ... drink a glass of mild anda sandwich 3.1.6 Parts of meal Basically, English meals and meal time are quite clear Even name of courses are also: starter, main course/ meat course and dessert Actually, ... the market Market-goers can squat, sit on a bench or eat and walk or eat and stand at the same time 4.2.4 Pubs and bars Generally speaking, pubs and bars are new types of eating have come into...
... GAGTTATCAACGACGAGTGTCC GAGACGACAAGGCTCAGTCC AAAGGTTTCCTCCACCCTGT ACTTCCTCGAGCTTGTCACG GACTTGGAGCACGTGTGT TATTGGTCAAACTCGTCCAT AAGACAGGAATGGCGAGT AATCTCTCAGCTCTTCGGGAC AAACGGTCACCCTCCTTGA ACTTCCTCGAGCTTGTCACG Product ... traps in the Menai Strait, UK, and maintained ina recirculating seawater system under ambient conditions MIH and CHH were purified from sinus gland extracts by HPLC and quantified by amino acid ... 30 Kotlyar, S., Weirauch, D., Paulsen, R.S & Towle, D.W (2000) Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus...
... full-length cDNA of the calcium and integrin binding protein (CIB) in frame with the GAL4 AD Mapping of regions involved in the interaction show that CIB and FEZ1 bind in the same domain of NBR1 To ... proteinanda phosphotyrosine-independent ligand of the p56lck SH2 domain share a common domain composition and organization, consisting of an octicosapeptide repeat domain, a ZZ zinc ®nger anda ... coiled-coil and (UBA) ubiquitin-associated domain The amino acids encoding each domain are shown below and the ®gure is not drawn to scale (B) Yeast two-hybrid assay analysis identi®es CIB and FEZ1 as interacting...