equestris and a thaliana o sativa p trichocarpa and v vinifera

báo cáo khoa học: " ZINC-INDUCED FACILITATOR-LIKE family in plants: lineage-specific expansion in monocotyledons and conserved genomic and expression features among rice (Oryza sativa) paralogs" ppsx

Ngày tải lên : 11/08/2014, 11:21

... each monocot and dicot species analyzed (A) Oryza sativa, (B) Sorghum bicolor, (C) Zea mays, (D) Brachypodium distachyon, (E) Arabidopsis thaliana, (F) Vitis vinifera, (G) Populus trichocarpa ... dicots group (Figure 2) Species-specific gene duplications are observed in Arabidopsis (AtZIF1 and AtZIFL1), V vinifera (VvZIFL2 and VvZIFL3; VvZIFL4 and VvZIFL5) and P trichocarpa (PtZIFL1 and ... genomes of Vitis vinifera, Populus trichocarpa, Sorghum bicolor, Brachypodium distachyon, Zea mays, Selaginella moellendorffii and Physcomitrella patens at the Phytozome database (http://www.phytozome.net/),...

22
206
0

Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

Ngày tải lên : 21/02/2014, 15:20

... necessary to obtain that information Here, we present the STD NMR epitope mapping and trNOE-based conformational analysis of the MUC-1 peptide PDTRP and the MUC-1 glycopeptide PDT (O- aD-GalNAc)RP (cf ... at pH 7.0 This corresponds to a ligand to protein ratio of 20 : For STD experiments the ligand to protein ratio was raised to 150 : (2.88 lmol, 4.8 mM PDT (O -a- D-GalNAc)RP) Peptide or glycopeptide ... magnet instability artefacts The so called on resonance irradiation of the protein was performed at a chemical shift of )2 ppm Off resonance irradiation was applied at 40 p. p.m., where no protein...

12
717
0

Báo cáo khoa học: Genomic structure, promoter analysis and functional mutation pptx

Ngày tải lên : 23/03/2014, 21:21

... account for the differential expression levels between the AQPap and AQPap-like genes PPARc-mediated induction of AQPap transcription Inspection of the human AQPap promoter revealed a putative ... Fukumoto (Gracia Hospital), Kazuya Yamagata, and Kikuko Hotta for providing the samples We are grateful to Yuko Matsukawa and Sachiyo Tanaka for excellent technical assistance This work was supported ... RT-PCR was carried out using the following primers AQPap: 5¢-CAAA GATCCAGGAAATACTGC-3¢, and 5¢-CCCAGCGCAC AGTTAGCA-3¢; AQPap-like; 5¢-AAATATGGTGCGAG GAAGATG-3¢, and 5¢-CCCAGCGCACAGTTAGTG-3 PCR...

13
511
0

Báo cáo sinh học: " Baculovirus-mediated promoter assay and transcriptional analysis of white spot syndrome virus orf427 gene" docx

Ngày tải lên : 19/06/2014, 08:20

... analysis of orf427 compared with immediate-early gene ie1 A) Genomic organization of vAcProie1-EGFP and vAc-Pro427-EGFP Pie1, promoter of ie1 gene; P4 27, promoter of orf427 Recombinant baculoviruses ... expression in the primary shrimp cells Recently AcMNPV (Autographa californica multiple nucleopolyhedrovirus), containing an appropriate eukaryotic promoter, was used to efficiently transfer and express ... transcription factor and enables the establishment Page of (page number not for citation purposes) Virology Journal 2005, 2:71 http://www.virologyj.com/content/2/1/71 A Pie1 EGFP cDNA vAc-Proie1-EGFP...

7
459
0

Báo cáo hóa học: " Analysis of in vitro replicated human hepatitis C virus (HCV) for the determination of genotypes and quasispecies" docx

Ngày tải lên : 20/06/2014, 02:20

... between patients and isolates A) Comparison of patient 081 sera with two HCV isolates: 081-T1, and 112AB-T1 B) Comparison of patient 238 plasma HCV and 238-T1 C) Comparison of patient 313 plasma HCV ... transmission sometimes wasn't known, but the first date of isolation of HCV RNA from that isolate was used to obtain an approximate date b Date HCV isolated from blood c Approximate date of transmission ... non-responsive to HCV therapy have a G at position 198 [22], which is the same as sample PCLB-T 4a Our isolates had a C or A at position 204, while other reports have found C, A, or U at the same...

15
340
0

báo cáo hóa học:" Baculovirus-mediated promoter assay and transcriptional analysis of white spot syndrome virus orf427 gene" pptx

Ngày tải lên : 20/06/2014, 04:20

... analysis of orf427 compared with immediate-early gene ie1 A) Genomic organization of vAcProie1-EGFP and vAc-Pro427-EGFP Pie1, promoter of ie1 gene; P4 27, promoter of orf427 Recombinant baculoviruses ... expression in the primary shrimp cells Recently AcMNPV (Autographa californica multiple nucleopolyhedrovirus), containing an appropriate eukaryotic promoter, was used to efficiently transfer and express ... transcription factor and enables the establishment Page of (page number not for citation purposes) Virology Journal 2005, 2:71 http://www.virologyj.com/content/2/1/71 A Pie1 EGFP cDNA vAc-Proie1-EGFP...

7
328
0

Báo cáo y học: "Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis" pot

Ngày tải lên : 14/08/2014, 14:21

... thanks to the maturation of gene-expression microarrays and the development of advanced computational approaches for analysis of the volumes of data generated by this technology Another technological ... a combination of two different siRNAs.) Rel _A: 5'-GATCCCCGAAGAGTCCTTTCAGCGGATTCAAGAGATCCGCTGAAAG GACTCTTCTTTTTGGAAA -3' p5 3: 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG GAGTCTTTTTGGAAA-'3 ... 5'-GATCCCCCTGGTTAGCAGAAACGTGCTTCAAGAGAGCA CGTTTCTGCTAACCAGTTTTTGGAAA-'3 ATM_II (p4 80): 5'-GATCCCCGATACCAGATCCTTGGAGATTCAAGAG ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', a generous gift from R Agami (ATM level was knocked-down using...

8
248
0

simultaneous determination of PAHs and PCBs by GCMS Analysis

Ngày tải lên : 09/09/2015, 09:39

... redevelopment and increased road traffic are all potential sources of air-borne particle pollution (Department for Environment, Food and Rural Affairs, 2001) 1.2 POLYCYCLIC AROMATIC HYDROCARBONS ... ENVIRONMENT, FOOD AND RURAL AFFAIRS 2001 The Air Quality Strategy for England, Scotland, and Wales and Northern Ireland; A consultation document on proposals for air quality objectives for particles, ... and SANTODONATO, J 1992 Exposure to carcinogenic PAHs in the environment Environmental Science and Technology, Vol 26, 1278–1284 OSPAR 1997 Oslo And Paris Conventions For The Prevention Of Marine...

17
328
0

Static and Dynamic Analysis of Space frames

Ngày tải lên : 06/09/2012, 15:18

... Values, drawn by option PLASC can have GLOBAL or LOCAL direction (PlSys) Additional options EXP/NOEXP added in PlSys editor to choose between E- and Fformat of the written values Information about ... existing data (factors for “favourable” and “unfavourable”) after installation of latest version Modified consideration of “favourable” / “unfavourable” in the load combination 3.66 Version 8.37.05 ... RM2000 Important notes Release notes 8.63.03 1 Important notes 1.1 Tdv2000 applications require a basic installation The basic part of Tdv2000 applications has been separated from the application (e.g...

19
633
0

Static and Dynamic Analysis of Spaceframes

Ngày tải lên : 06/09/2012, 15:55

... Inp1: Loading case number defined for T-MAX Repeat Repeat the above procedure for T-MIN The program prepares and stores the full load-set input data for T-MAX and TMIN from the above data Recalc ... Stage - Action Temp-Var Insert a calculation action “TempVar”: Inp1: Group-name (TEMP-MAX, named in GEOP2000) Out1: Load-set number defined above for T-MAX Calc Insert a calculation action “CALC”: ... arne.bruer@tda-as.no Fax: +47-2272-0959 Internet: http://www.tda-as.no Support in Portugal and Spain: GIPAC - Gabinete de Informática e Projecto Assistido por Computador, Lda Rua Carlos Seixas 176, 1° Dto...

34
1.1K
1

Static and Dynamic Analysis of Spaceframes

Ngày tải lên : 06/09/2012, 15:55

... empty database) #DEFAULTS Setup and import template data #OPEN Open an existing project or start a new one #IMPORT Import a saved project (or a part of it) #EXPORT Export (save) the current project ... Calculator program Opens the default editor program (Textpad or Notepad) Opens a program for plotting graphical results Lists all freehand symbols for zooming functions Opens a dialogue window ... database by using the function "PROPERTIES #VARIABLES Chapter 3.5 provides full information on the use and application of variables Variables can be imported into the program from variable tables...

484
1.2K
1

SAP2000® Linear and Nonlinear Static and Dynamic Analysis and Design of Three-Dimensional Structures

Ngày tải lên : 06/09/2012, 15:56

... and if at any time you need to stop, save your model so that you may continue at a later time Welcome to SAP2000 1-2 Overview of the Program Chapter An Introductory Tutorial This chapter provides ... tutorial, and that you find it beneficial as a starting point in your exploration of this powerful and comprehensive version of SAP2000 Using this Manual 1-1 Introductory Tutorial for SAP2000 Version ... on your computer before you can begin the tutorial It would also be a good idea to peruse the other SAP2000 documentation prior to starting this tutorial, or at least have them readily available...

47
1.4K
2

A pragmatics and conversation analysis perspective

Ngày tải lên : 07/11/2012, 14:26

... normative-volitional approach to politeness study is appropriate and reasonable Conversation analysis sheds light on disagreements as dispreferred seconds to first assessments and opinions, and as ... of spontaneous speech like pronunciation, intonation, pace, volumes, the location and duration of pauses, and tone could be captured and contribute to the analytic process New approaches to the ... interests of social psychology, communication, discourse analysis, sociolinguistics, pragmatics and so on The early theoretical and methodological developments of this approach date back to 1950s and...

249
773
2

Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.

Ngày tải lên : 15/04/2013, 15:11

... breakfast as well as conditional breakfast They often have cereal or porridge, egg and bacon followed by toast and marmalade and coffee and tea or they may just have a toast and marmalade and coffee ... where many hot arguments happen and opposite view is pointed out However, the level of arguments are always stopped at suitable point It means that peoples action and words never go beyond meal limit ... place at oclock tea At that time people often have a meal with sandwiches, scones, butter and jam and cake with a pot of tea 3.1.3.2 Afternoon tea The tradition of afternoon tea goes many years...

54
1K
1

Finance reports and stock analysis

Ngày tải lên : 25/07/2013, 14:52

... international, USA; Rockport company; Ralph Lauren Footwear and Greg Norman Collection Products of Reebok are now available in over 140 countries including main markets North America, Europe and Asia among ... Financial analysis of Reebok The Reebok brand designs, produces and markets sports, fitness and casual footwear, appareel and accessories that combine characteristiics of sport and style Products of ... allows all competitors compete equally and freely and it Group 4th - A2 .FBA.K38 Financial analysis of Reebok leads companies to reduce their labor and manufacturing costs to maintain company’s profitabilitty...

25
330
0

Long-term Performance and Community Analysis of Spirodela Polyrrhiza–bacteria Association Treating Phenol-contaminated Water

Ngày tải lên : 05/09/2013, 10:15

... conclusions are as follows: (1) Accelerated removal of phenol by an S polyrrhiza–bacteria association in pond water was observed in comparison to the removal of phenol by the pond water bacteria alone ... The phenol degradation ability of S polyrrhiza–bacteria association was rapidly enhanced by exposure to phenol compared with the pond water bacteria alone The enhanced phenol degradation rate of ... Mori K., Ike M and Fujita M (1999) Design of PCR primers and gene probes for the general detection of bacterial populations capable of degrading aromatic compounds via catechol cleavage pathways,...

12
476
0

Energy and exergy analysis of particle dispersed latent heat storage system

Ngày tải lên : 05/09/2013, 16:10

... becomes low as compared to that for lower values Moreover, operating the system with lower HTF inlet temperature provides less temperature drop.This is preferable from application point of view ... interface whose position is unknown a priori and also flow problems associated with HTF In addition, the two phases of PCM may have different properties and configuration of the LHTS unit may differ ... paraffin and copper The thermophysical properties of PCM [17] and copper [7] are given in Table Water is used as HTF as the system corresponds to that one used for solar water heaters Table Thermophysical...

14
510
1

Energy efficiency and cost analysis of canola production in different farm sizes

Ngày tải lên : 05/09/2013, 16:30

... investigation was conducted on canola farms in Golestan province, Iran Golestan province is the most important centre of canola production in Iran The province is located within 36° 30' and 38° 08' north ... production value ($ ha-1) – Variable cost of production ($ ha-1) Net return = Total production value ($ ha-1) – Total production costs ($ ha-1) Benefit - Cost ratio = Total production value ($ ha-1) ... spreadsheet and SPSS 17.0 software programs Results and discussion 3.1 Analysis of input-output energy use in canola production The amount of inputs and outputs for canola production in different farm...

8
473
0