enforce the singleton property with a private constructor or an enum type
effective java 2nd edition may 2008 3000th release
... safer than JavaBeans ITEM 3: ENFORCE THE SINGLETON PROPERTY WITH A PRIVATE CONSTRUCTOR OR AN ENUM TYPE Item 3: Enforce the singleton property with a private constructor or an enum type A singleton ... of a public constructor has both advantages and disadvantages One advantage of static factory methods is that, unlike constructors, they have names If the parameters to a constructor not, in and ... and Patterns Rosanna Lee, Scott Seligman JNDI API Tutorial and Reference: Building DirectoryEnabled Java™ Applications Patrick Chan The Java™ Developers Almanac 1.4, Volume Sheng Liang The Java™...
- 369
- 744
- 0
Introduction to Design Patterns in C#
... this separation, among them encapsulation and inheritance Nearly all languages that have OO capabilities support inheritance A class that inherits from a parent class has access to all of the methods ... differences are that VB7 is more Visual Basic like and a bit easier for VB programmers to learn and use C# on the other hand is more C++ and Java- like, and may appeal more to programmers already experienced ... grouped into the general categories of creational, structural, and behavioral patterns Many of the patterns stand more or less independently, but we take advantage of already discussed patterns from...
- 424
- 522
- 2
Introduction to Design Patterns in C# doc
... this separation, among them encapsulation and inheritance Nearly all languages that have OO capabilities support inheritance A class that inherits from a parent class has access to all of the methods ... differences are that VB7 is more Visual Basic like and a bit easier for VB programmers to learn and use C# on the other hand is more C++ and Java- like, and may appeal more to programmers already experienced ... grouped into the general categories of creational, structural, and behavioral patterns Many of the patterns stand more or less independently, but we take advantage of already discussed patterns from...
- 100
- 481
- 0
Introduction to Design Patterns in C# pot
... this separation, among them encapsulation and inheritance Nearly all languages that have OO capabilities support inheritance A class that inherits from a parent class has access to all of the methods ... differences are that VB7 is more Visual Basic like and a bit easier for VB programmers to learn and use C# on the other hand is more C++ and Java- like, and may appeal more to programmers already experienced ... grouped into the general categories of creational, structural, and behavioral patterns Many of the patterns stand more or less independently, but we take advantage of already discussed patterns from...
- 424
- 417
- 0
An Introduction to Design Patterns in C++ with Qt™, 2nd Edition doc
... C or another procedural language and want to learn OO and GUI programming, to those who have no C background but are familiar with Basic, Java, Python, or another programming language and want ... language standard for it In 1997, a committee of the American National Standards Institute (ANSI) completed and published internally the Draft Standard The C++ Language, X3J16/97-14882, Information ... sorting and filtering, cut and paste, and drag and drop The section on threads has been completely rewritten to highlight the advantages of using QtConcurrent algorithms rather than managing the...
- 766
- 3,099
- 1
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
- 2
- 1,418
- 3
Guide to Computer Naming Schemes and Conventions
... in the 6th floor of the Headquarters in Cleveland Ohio would start with "CLVHQ06SV" This name takes up characters, allowing for additional characters which can include additional identification ... name during the remote installation request The default format is the user name with an appended incremental number You can also create a custom naming policy; to this, click Customize You can ... computer name %# The name includes an incremental number %Last The user's last name is used as the computer name %MAC The network card media access control address is used as the computer name To...
- 2
- 395
- 0
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
... generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ring to them As a matter ... sunglasses restaurant warm elegant friendly original italian tasty cozy modern eatalian pastarant peatza italian, eat restaurant, pasta pizza, eat dusta hometess pasta, dust hostess, home shampoo smooth ... majority class for each dimension With annotators, a majority class greater than or equal to means that the absolute majority of the annotators agreed on the same decision Table shows the distribution...
- 9
- 518
- 0
Báo cáo khoa học: "Can Click Patterns across User’s Query Logs Predict Answers to Definition Questions?" ppt
... Information in Natural Language Applications Donghui Feng, Deepak Ravichandran, and Eduard H Hovy 2006 Mining and Re-ranking for Answering Biographical Queries on the Web In AAAI Aaron Fernandes ... requires substantial human efforts to tag a large corpus, and disagreements between annotators are not uncommon • (Figueroa and Atkinson, 2009) capitalized on abstracts supplied by Wikipedia for building ... Sautter, Manas Pathak, and Eric Nyberg 2007 Semantic Extensions of the Ephyra QA System for TREC 2007 In Proceedings of TREC 2007 NIST Mihai Surdeanu, Massimiliano Ciaramita, and Hugo Zaragoza...
- 10
- 420
- 0
php architects guide to php design patterns jason e sweat july 2005
... "as-is" and the publisher, the author(s), their distributors and retailers, as well as all affiliated, related or subsidiary parties take no responsibility for any inaccuracy and any and all damages ... greater than the player’s balance (Such a circumstance would then return the players balance and perhaps raise a “BankruptException” to calculate a modified payment instead of the full amount The ... all but the simplest applications, most objects have an “identity.” An important business object, such as a Customer or a SKU, will have one or more attributes an ID, or a name and an email address,...
- 337
- 405
- 0
báo cáo sinh học:" Workforce analysis using data mining and linear regression to understand HIV/AIDS prevalence patterns" pdf
... prevalence rate Analytic method Two approaches were used for analysis: data mining using classification and regression trees (CART) and standard statistical analyses using ordinary least squares ... some of the same variables used in the CART approach, with the intent to build the best explanatory model (highest explained variance and theoretically important independent variables) Because of ... antiretroviral therapy in a home-based AIDS care programme in rural Uganda Lancet 2006, 368:1587-1594 Akiki FS: The focus on women Kampala declaration: Ugandan women call for action on HIV/AIDS BMJ...
- 6
- 490
- 0
báo cáo hóa học: " Using visual feedback distortion to alter coordinated pinching patterns for robotic rehabilitation" ppt
... Data from the first no-feedback trial were excluded The total mean absolute error was significantly larger for no-feedback trials than for the with- feedback trials, but a decrease in total absolute ... stated that they tried to move the finger and the thumb in a coordinated way And all subjects stated that the task required a significant amount of concentration and felt that the task was extremely ... Trial absolute error is the mean absolute difference between the normalized position of each finger and the goal finger location Mean absolute error is the sum of the trial absolute error for each...
- 9
- 302
- 0
báo cáo hóa học: " Effects of low dose GM-CSF on microglial inflammatory profiles to diverse pathogen-associated molecular patterns (PAMPs)" potx
... supernatants were collected and analyzed for TNF-α (A) and MIP-2 (B) expression by ELISA (mean ± SD) Microglial cell viability was assessed using a standard MTT assay and the raw OD570 absorbance ... incubated with a MHC class-II antibody (rat anti-mouse, BD Pharmingen) overnight at 4°C The following day, cells were incubated with a donkey anti-rat biotinylated secondary antibody (Vector Laboratories, ... recovered and stained with MHC class II, CD40, CD80, or CD86 antibodies and subsequently with a FITCconjugated secondary antibody for flow cytometric analysis Microglia were stained with an isotype-matched...
- 18
- 369
- 0
Báo cáo hóa học: " Changing patterns in diagnostic strategies and the treatment of blunt injury to solid abdominal organs" docx
... Miller LA, Shanmuganathan K: Multidetector CT evaluation of abdominal trauma Radiol Clin North Am 2005, 43:1079-95, viii 18 Jayaraman S, Sethi D: Advanced trauma life support training for hospital ... Catalano O, Aiani L, Barozzi L, Bokor D, De Marchi A, Faletti C, Maggioni F, Montanari N, Orlandi PE, Siani A, Sidhu PS, Thompson PK, Valentino M, Ziosi A, Martegani A: CEUS in abdominal trauma: ... FAST can be performed simultaneously with resuscitation efforts during the initial trauma management and can be completed rapidly FAST is, therefore, also useful in hemodynamically unstable patients...
- 9
- 446
- 0
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" potx
... removing the repeats that due to single base repeat pattern, for instance, repeat like AAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of period is of no interest In step (4), the ... IEEE Signal Processing Magazine, vol 18, no 4, pp 8–20, 2001 [16] S Tiwari, S Ramachandran, A Bhattacharya, S Bhattacharya, and R Ramaswamy, “Prediction of probable genes by Fourier analysis of ... 19, and 49 reported by our algorithm are: AC, CTGGGAGAGGCTGGGATTG, CTGGGAGAGGCTGGGAGAG, GAGGCTGGGAGAGGCTGGGAGAG∗CTGGGAGAGGCTG∗GATTGCTGGGA (where ∗ represents any of the four nucleotides, i.e., A, ...
- 7
- 206
- 0
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" pdf
... removing the repeats that due to single base repeat pattern, for instance, repeat like AAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of period is of no interest In step (4), the ... IEEE Signal Processing Magazine, vol 18, no 4, pp 8–20, 2001 [16] S Tiwari, S Ramachandran, A Bhattacharya, S Bhattacharya, and R Ramaswamy, “Prediction of probable genes by Fourier analysis of ... 19, and 49 reported by our algorithm are: AC, CTGGGAGAGGCTGGGATTG, CTGGGAGAGGCTGGGAGAG, GAGGCTGGGAGAGGCTGGGAGAG∗CTGGGAGAGGCTG∗GATTGCTGGGA (where ∗ represents any of the four nucleotides, i.e., A, ...
- 7
- 391
- 0
Báo cáo khoa học: An answer to a question by Wilf on packing distinct patterns in a permutation potx
... permutation of length n + that contains π as well as at least 2f (π) patterns This, with the upper bound, would be a clean proof that h(n) grows asymptotically as 2n and allow for more understanding ... occupy the same position within the same segment and are, in fact, equal Therefore, q coincides with r We’ve shown that two identically ordered subsequences must actually be the same, and 2 our claim ... insignificant, as n k with k! As n n < k! k for all k above a breakpoint which grows much slower than n Wilf demonstrated a class of permutations Wn for which f (Wn ) asymptotically is √ greater than...
- 4
- 284
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose