... organization ofan integrated set of constraints over the value that can be taken by a set of variables (both extensive and intensive) In this way, we can facilitate the discussion and evaluation ... Multi-Scale Integrated Analysis of Agroecosystems Case Study: An Epistemological Analysis of the Failure of Conventional Energy Analysis Attempts to apply energy analysis to human systems have a long ... Application of ILA to farming system analysis EV1, hectares of land; EV2,Yuan—Southeast China FIGURE 7.15 Application of ILA to farming system analysis EV1, hours of human activity; EV2,Yuan— Southeast...
... listened to on the computer or downloaded onto an MP3 player, such as an iPod Naturally the advent of the podcast has also meant that media brands have been able to invade one another’s traditional territory ... defining characteristics of social media are the blurring of definitions, rapid innovation, reinvention and mash-ups Each explanation also has a section on how to try out that form of social media yourself, ... of the scientific entries in Wikipedia and Encyclopaedia Britannica No one was surprised that Encyclopaedia Britannica was the more reliable of the two – what was remarkable was that it was only...
... position and isolate the contact area from vibration and other forms of mechanical stress Flexible silver-plated contact tags, arranged at 45o angles across the axis of the wire, make a solid gastight ... installations (DATA SIDE) CONCEPT Another possible implementation ofa HIGHBAND solution involves wiring the port appearances of your data services to a dedicated appearance on your cross connect frame ... gastight connection Constant axial and torsional restoring forces, created by the unique contact and plastic housing, maintain a durable connection that allows up to 200 re-terminations The HIGHBAND...
... mobaraensis usually forms exospores on solid agar containing only glucose, yeast and malt extracts, and calcium carbonate Formation of aerial mycelium is Ó FEBS 2003 Transglutaminase-activating metalloprotease ... residues of dimer pro-TGase (that can also be stained by TGase-specific antibodies), indicated by faint bands at Fig Identification of the transglutaminase (TGase)-activating protease (A) Silver-stained ... membrane and analysed by Edman degradation The N-terminal sequence was clearly identified as Phe-Arg-Ala, reflecting a cleavage site Fig Silver-stained SDS gel of purified transglutaminase-activating...
... Thomson on Teleology Dr Asa Gray Darwinism tantamount to Atheism Advertisements WHAT IS DARWINISM? This is a question which needs an answer Great confusion and diversity of opinion prevail as to ... real views of the man whose writings have agitated the whole world, scientific and religious If a man says he is a Darwinian, many understand him to avow himself virtually an atheist; while another ... origin of the universe (2.) It accounts for all the universe contains, and gives a satisfactory explanation of the marvellous contrivances which abound in living organisms, of the adaptations of...
... mutagenesis Oligonucleotides used for this step were: VpuB/PacI (5’-GCTCATCAGAACAGTCAGATTAATTAAGCTTCTCTATCAAAGC-3’) VpuB/Eco47III (5’-GGGATATTGATGATCTGTAGCGCTACAGAAAAATTGTGGGTC-3’) The second ... p24-normalized inocula at 1:1 ratio Each variant ratio was determined by clonal analysis of viral population present in culture supernatants Error bars indicate standard errors Results are representative ... GTCAGATTAATTAAGCTTCT Vpu TTAATTAA - -AGCGCT Vpu BF .TTCTGTAGAGCGCTACAGA Ligation pVpuBF PacI pNL4-3 VpuB PacI/Eco47III Digestion + Ligation pNL4-3 VPUBF Eco47III Figure Structural analysis of...
... addressing a person or thing A noun used to address a person or thing is said to be in the vocative case Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org ... vocative case Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered by TCPDF (www.tcpdf.org) ...
... parenteral administration of oat beta glucan and these enhanced responses may play an important role in providing resistance to bacterial and parasitic infection Current pharmacological treatments ... infection and complications, in the glucan patients At Minoo City Hospital in Japan (Japanese Journal of Cancer and Chemotherapy v 30, 1981) lentinan glucan was given to more gastric cancer patients ... was done regarding all beta glucans as treatments for cancer and mutations They recommended their use in humans with malignancies as standard treatment At the famous Mayo Clinic (International...
... was adopted in 1998 by the ISO, IEC (International Electrotechnical Committee), and ANSI This book is based on that standard The ANSI/ISO C++ standard additionally draws upon the ANSI C standard, ... cfront and with G++ Thanks to Nan Borreson of Borland International for her responsive and cheerful assistance with Turbo C++ and Borland C++ Thank you, Ruth Myers and Christine Bush, for handling ... programming than the binding of data and methods into a class definition OOP, for example, facilitates creating reusable code, and that eventually can save a lot of work Information hiding safeguards...
... soluble rat CD4 (a gift of N Barclay, Oxford, UK) The data were analyzed in accordance with the method of Karlsson et al [S1], and the association rate constant kass, the dissociation rate constant ... Increased expression of IL-4 and IL-10 and decreased expression of IL-2 and interferon-gamma in long-surviving mouse heart allografts after brief CD4-monoclonal antibody therapy Transplantation 1995, ... extent of erythema and edema of the periarticular tissue, ona scale of 04, where = no inflammation, = unequivocal inflammation of one paw joint, = unequivocal inflammation of at least two paw joints...
... deviation of the left mandible and masticator muscles anteriorly The airway at the pharyngomucosal space was compressed and stenosed A CT scan of our patient’s brain and neck showed a large heterogeneous ... JF, Angtuaco EJ: Nasopharyngeal brain heterotopia: a cause of upper airway obstruction in infancy Laryngoscope 1984, 94:818-819 Patterson K, Kapur S, Chandra R: Nasal glioma and related brain heterotopias: ... cleft palate Cleft Palate Craniofac J 1999, 36:248-251 Hendrickson M, Faye-Petersen O, Johnson DG: Cystic and solid heterotopic brain in the face and neck: a review and report ofan unusual case...
... (iii) Translation by cultural substitution; (iv) Translation by using a loan word or loan word plus explanation; (v) Translation by paraphrase using a related word; (vi) Translation by paraphrase ... percentage of semantic strategies 13 4.3 LOSS AND GAIN IN MEANING OF METAPHORS IN THE TRANSLATIONAL VERSION BY PHAN NGOC 4.3.1 Loss of Meaning in lexical feature a Loss of Conceptual Meaning The translator ... original and translational versions We found six strategies suggested by Mona Baker which the translator adapts to translate They are (i) Translation by using omission; (ii) Translation by using a...
... mentioned, you probably won't need to change any file transfer options However, you can change an option by typing the letter that appears to its left, typing the desired value of the option, and ... will probably not take advantage of special capabilities afforded by your modem You can consult your modem documentation and revise the command strings to incorporate the codes that activate your ... PPP Options The Linux PPP client requires several configuration files Rather than build these files manually, you can use pppconfig, a program that leads you through a dialog and then creates the...
... phenomenon can be heard in the rigorous pronunciation ~f standard German, 'Buhnendeutsch') Equally, it has a reluctance to admit an unvowelled consonant" as an initial sound (i.e an initial consonant ... description ofa language can avoid the use ofa grammatical terminology This is always a difficult problem, and particularly so when one is dealing with a non-European language, for which the conventional ... is a handful of nouns having only two consonants, like .l: 'hand', and a certain number of four-consonant roots The actual form of any given word is created by filling Out the rOOt consonants...
... antisense primers (WS1, 5'-ATAAGCTTAGCAGAAGACA-3', and 3'envMD4, 5'-GCAAAATCCTTTCCAAGCCC-3') in a 50 µl PCR reaction DNA products were analysed ona 1% agarose gel that was pre-stained with ethidium ... 292:7-7 Das AT, van Dam AP, Klaver B, Berkhout B: Improved envelope function selected by long-term cultivation ofa translationimpaired HIV-1 mutant Virol 1998, 244:552-562 Das AT, Land A, Braakman ... but we gradually used less culture supernatant per passage Cells and supernatant samples were taken at regular time points and stored at -70°C Proviral DNA isolation, PCR amplification and sequencing...
... 5'-TTCTGA TAA TGC TGA AAA CAT GGG TAT and inner primer pair 5'-CTC TCG ACG CAG GAC TC and 5'-ACC CAT GCA TTT AAA GTT CTA G was used As an internal control, the human β-globin RNA was amplified ... membrane and probed with rabbit anti-CypA antibody (Calbiochem, 1:2,000) and as secondary antibody horseradish peroxidase-conjugated anti-rabbit IgG Rec CypA, recombinant CypA; NT, non-transfected ... conformational adaptations in antigen and antibody upon complex formation between an Fab and HIV-1 capsid protein p24 Structure 2000, 8(10):1069-1077 Abdurahman S, Hoglund S, Goobar-Larsson L, Vahlne...