emerging components in a model or theory of motivational interviewing
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
Ngày tải lên :
16/03/2014, 16:20
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...
- 12
- 512
- 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx
Ngày tải lên :
17/03/2014, 11:20
... multivariate and machine learning approaches are appropriate for such problems, and so we used the evolutionary programming algorithms incorporated in the metabolic modelling package GEPASI [14–16] ... evolutionary optimization in this paper in order to avoid underdetermination We were initially concerned that in ignoring kinetic parameters for fitting, we could be ignoring critical factors for model ... using tables therein Principal components analysis (PCA) [24–26] was performed using HOBBES, an in- house multivariate statistics package [27,28] Parameter fitting was performed on the model using...
- 11
- 530
- 0
gorban a.n. singularities of transition processes in dynamical systems.. qualitative theory of critical delays (ejde monograph 05, 2004)(55s)
Ngày tải lên :
24/04/2014, 16:50
... mechanisms of slow relaxations can be readily mentioned: The delay of motion near an unstable fixed point, and the delay of motion in a domain where a fixed point appears under a small change of parameters ... motion satisfying the condition can be considered a trajectory going from a fixed point to the same point (for example, the loop of a separatrice), or a homoclinical trajectory of a periodical motion ... of the axis are non-wandering; is the place of delay near fixed points Lemma 3.5 A closed invariant set W is Lyapunov stable if and only if it has a fundamental system of positively invariant closed...
- 55
- 252
- 0
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt
Ngày tải lên :
18/06/2014, 16:20
... ALDHhiLin-transplanted animals (Figure 2) and in four of six ALDH lo Lin - transplanted animals (data not shown) The human engraftment in the ALDH hi Lin transplanted animals was generally more ... triangle) sorted human UCB cells or PBS (Blue diamond) Echocardiographic images were recorded on the day of transplantation (day 0) and again at day and day 28 Segmental wall motion scoring index ... can be visualized in situ without adversely affecting cell viability and engraftment potential by a combination of nanoparticle labeling and whole organ fluorescent imaging [17] Using a similar...
- 13
- 506
- 0
báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf
Ngày tải lên :
19/06/2014, 22:20
... in cerebral vasculature by anandamide provides a new mechanism that may explain the therapeutic action of increased anandamide tone in neuroinflammatory diseases like MS Additional material Additional ... Garc a- Merino A, Ramos JA, Di Marzo V, Fernández-Ruiz J: Decreased endocannabinoid levels in the brain and beneficial effects of agents activating cannabinoid and /or vanilloid receptors in a ... and degradation enzymes (FAAH, MAGL) and proteins involved in their transport, and intracellular trafficking [9] Increasing evidence suggests the involvement of the ECS in both the inflammatory...
- 13
- 466
- 0
báo cáo hóa học: " Modulation of spinal cord synaptic activity by tumor necrosis factor alpha in a model of peripheral neuropathy" potx
Ngày tải lên :
19/06/2014, 22:20
... Bhuskute A, Sorkin LS: Peripheral inflammation induces tumor necrosis factor dependent AMPA receptor trafficking and Akt phosphorylation in spinal cord in addition to pain behavior Pain 2010, ... Svizenska I, Pejchalova K: Intra- and extraneuronal changes of immunofluorescence staining for TNF-alpha and TNFR1 in the dorsal root ganglia of rat peripheral neuropathic pain models Cell Mol Neurobiol ... Modulation of spinal cord synaptic activity by tumor necrosis factor α in a model of peripheral neuropathy Diana Spicarova, Vladimir Nerandzic and Jiri Palecek Department of Functional Morphology,...
- 23
- 381
- 0
Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx
Ngày tải lên :
20/06/2014, 00:20
... conterstain The AgNOR analysis was performed by counting the number of AgNOR (black dots) per cell at a magnification of 1000× (each group n = animals) Analysis of data The secretory basal and stimulated ... of glandular and surface epithelial cells To assess the proliferative activity, an in vivo BrdU-assay and AgNOR-analysis were performed Positive staining indicating BrdU incorporation was only ... 2005, 1:5 Hara J, Fujimura M, Myou S, Oribe Y, Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex...
- 10
- 568
- 0
Báo cáo lâm nghiệp: "Genetic variation of wood density components in a radiata pine progeny test located in the south of Chile" pps
Ngày tải lên :
08/08/2014, 00:21
... values for within ring area components with cambial age (A) EA; (B) LA All family mean values for EA increased after ring and reached a plateau between rings and After ring 7, family average tended ... followed an oscillating pattern of variation In their study of families of radiata pine established in several sites in New Zealand, Cown and Ball [8] also measured average ring density and determined ... 12% and resins were extracted with a solution of ethanol Intra-ring density information for each sample was obtained by using an indirect-reading X-ray densitometry system at the INRA Research...
- 10
- 341
- 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
Ngày tải lên :
08/08/2014, 23:21
... place after treatment and included both a retrospective pretreatment and a follow-up rating Finally, the research staff obtained a list of medications before and after treatment in order to ascertain ... examine for any associations between the demographic variables and the total score of the BPRS, BSI, and Client Observation Scale General linear model (mixed model analysis of variance (ANOVA)) was ... Gunderson JG: Borderline Personality Disorder: A Clinical Guide Washington, DC, USA: American Psychiatric Press; 2001 Geller JL: In again, out again: evaluation of a state hospital's "worst" recidivists...
- 12
- 477
- 0
Báo cáo y học: "Systematic mapping of two component response regulators to gene targets in a model sulfate reducing bacterium" ppt
Ngày tải lên :
09/08/2014, 23:20
... Systematic mapping of two component response regulators to gene targets in a model sulfate reducing bacterium Lara Rajeev, Eric G Luning, Paramvir S Dehal, Morgan N Price, Adam P Arkin and Aindrila ... described in Materials and Methods Nimblescan software was used to analyze the tiling array data and rank enriched gene loci for each RR The top 20 peaks obtained for each DAP-chip are provided in Table ... 8 Salgado H, Santos-Zavaleta A, Gama-Castro S, Peralta-Gil M, Penaloza-Spinola MI, Martinez-Antonio A, Karp PD, Collado-Vides J: The comprehensive updated regulatory network of Escherichia coli...
- 61
- 401
- 0
Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt
Ngày tải lên :
12/08/2014, 04:20
... contained both extracellular- and intracellular-infectious virions However, it is possible that UL56 plays a role in the intracellular transport and /or release of virions after formation of infectious ... membrane of vesicles containing virions, and interacts with proteins which are involved in membrane trafficking, transport or membrane fusion This interaction facilitates the transport and /or release ... 106:167-180 Harley CA, Dasgupta A, Wilson DW: Characterization of herpes simplex virus-containing organelles by subcellular fractionation: role for organelle acidification in assembly of infectious particles...
- 13
- 290
- 0
Báo cáo y học: "Association between inflammatory mediators and response to inhaled nitric oxide in a model of endotoxin-induced lung injury" docx
Ngày tải lên :
13/08/2014, 11:23
... Endotoxin also caused a rapid release of inflammatory mediators and vasoactive substances Prostanoids, LTB4, ET-1, nitrates and cytokines increased in the blood The vasoconstrictor TXB2 (a metabolite ... Effect of endotoxin Endotoxin exposure caused an increase in the MPAP and the pulmonary vascular resistance, whereas the cardiac output remained unaltered There was a mean decrease in the mean arterial ... Endotoxin Page of (page number not for citation purposes) Critical Care Vol 12 No Trachsel et al Table Cells and inflammatory parameters at baseline and before inhaled nitric oxide (INO) for responders...
- 8
- 363
- 0
Báo cáo y học: "Factors associated with internalizing or somatic symptoms in a cross-sectional study of school children in grades 1-10" potx
Ngày tải lên :
13/08/2014, 18:21
... variables First, each factor was included separately as a covariate, adjusting only for gender and grade Thereafter, all covariates were included simultaneously in a multivariable model These analyses ... Covariates are factors assumed to be associated with children’s stomach ache anxiety and headache, also after adjustment for a number of potentially confounding factors In separate analyses of boys ... three authors participated in designing the study AL and SL did the analyses AL, SL, and LJV interpreted the data and wrote the paper All authors read and approved the final manuscript Competing interests...
- 9
- 309
- 0
Báo cáo y học: "Hypervolemia induces and potentiates lung damage after recruitment maneuver in a model of sepsis-induced acute lung injury" pps
Ngày tải lên :
13/08/2014, 20:22
... and analysis of mechanical and morphometrical data CSS contributed to animal preparation, performance of experimental work, analysis of mechanical and morphometrical data, and drafting of the manuscript ... [9,21] All data were analyzed using ANADAT data analysis software (RHT-InfoData, Inc., Montreal, Quebec, Canada) Echocardiography Volemic status and cardiac function were assessed by an echocardiograph ... Normovolemia was maintained at a MAP of about 100 mmHg Hypervolemia was obtained with colloid administration (Gelafundin®; B Braun, Melsungen, Germany) at an infusion rate of ml/kg/min to achieve a MAP...
- 16
- 287
- 0
Báo cáo sinh học: "Marginal inferences about variance components in a mixed linear model using Gibbs sampling" ppsx
Ngày tải lên :
14/08/2014, 20:20
... thereof, such as intraclass correlations and variance ratios SETTING Model Details of the model and definitions are found in Macedo and Gianola (1987), Gianola et al (199 0a, b) and Gianola and Foulley ... transformation of random variables, we obtained the marginal density of the variance ratio y= a! /a; by fixing a; , using [40] as: If inferences are to be made about the intraclass correlation p ... Examples of estimating the densities of variance ratios and of an intraclass correlation are given later APPLICATION OF GIBBS SAMPLING TO THE ONE-WAY CLASSIFICATION Model We consider the one-way...
- 22
- 249
- 0
a study on theory of iceberg in the old man and the sea by earnest hemingway = nghiên cứu về nguyên lý tảng băng trôi trong tác phẩm ông già và biển cả của ernerst hemingway
Ngày tải lên :
02/03/2015, 14:25
... the surface This tale of an aged Cuban fisherman going head-to-head (or hand-to-fin) with a magnificent marlin encapsulates Hemingway's favorite motifs of physical and moral challenge If a younger ... language and meaning London Edward Arnold Halliday, M A K (1989) Context of situation In Michael Halliday and Ruqaiua Hasan, eds., Language, Context and Text: Aspects of Language in a Social-Semiotic ... the intangibles he craves Three times, Manolin professes his faith in Santiago In accepting the marlin's spear, Manolin demonstrates once and for all that he clearly understands and accepts all...
- 49
- 1.8K
- 7
On the conformation of DNA confined in a nanochannel or absorbed at an interface
Ngày tải lên :
14/09/2015, 14:01
... overall parameters such as temperature, pH or salinity In biological systems a similar goal is achieved by introducing a small quantity of condensing agents, such as short polyamines (spermine and ... and the intercalation of dye molecules for the fluorescence imaging of DNA These factors should be duly taken into account in the interpretation of the data Research Objectives The main aim of ... CONFORMATION OF DNA CONFINED IN A NANOCHANNEL OR ABSORBED AT AN INTERFACE BY ZHANG CE (B S.) DEPARTMENT OF PHYSICS A THSIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NATIONAL UNIVERSITY OF...
- 153
- 465
- 0
Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt
Ngày tải lên :
13/12/2013, 00:15
... of data packets each capable of transmitting to 1023 bytes of data Data0 Data1 Data packets have the following format Sync PID Data CRC16 EOP Handshake Packets There are three type of handshake ... error or a NAK packet indicating to the host that the endpoint is working, but temporary has no data to send IN DATA x ACK Data Error STALL NAK In Token Error Key OUT DATA x Host Function ACK NAK ... packet types Token packets indicate the type of transaction to follow, data packets contain the payload, handshake packets are used for acknowledging data or reporting errors and start of frame...
- 30
- 745
- 0