egyptians in which they ascribe to their science an antiquity of a hundred thousand years
Good Managers. . .What They Mean to Their Employees
... Indian workers associate an employee’s willingness to their very best and an employee’s sense of job security with having an effective manager Brazilian workers rate ethics as a driver of managerial ... • Manager is good at people management • • • • • People are motivated to their best Unfavorable Views of Immediate Manager • Rating of job security 80 Manager is ethical 70 • • In addition to ... that subordinate employees rate their managers favorably if the manager treats employees fairly, does a good job at managing the work, provides useful feedback and is a “people manager.” Laborers...
- 3
- 222
- 0
Tài liệu Which Bank Is the “Central” Bank? An Application of Markov Theory to the Canadian Large Value Transfer System doc
... sum of the T2NDCs In practice this is not quite true since the Bank of Canada is also a participant in the LVTS and acts as a drain of liquidity in Tranche Specifically, the Bank of Canada receives ... obtain the sum of bilateral credit limits granted to bank i However, a bank’s initial payments cannot exceed this amount times the system wide Bank of Canada grants to other banks in Tranche As ... Which Bank Is the “Central” Bank? An Application of Markov Theory to the Canadian Large Value Transfer System Morten L Bech, James T E Chapman, and Rod Garratt Federal Reserve Bank of New...
- 20
- 438
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... Gaizauskas and Y Wilks 1999 Compacting the Penn Treebank Grammar Proceedings of COLING-98 (Montreal), pages 699703 Table 2: F1-measure of top states during grammar parsing A McCallum, K Nigam, ... Bikel, R Schwartz and R M Weischedel 1999 An Algorithm that Learns What’s in a Name Machine Learning, 34:211–231 V R Borkar, K Deshmukh and S Sarawagi 2001 Automatic Segmentation of Text into Structured ... Hierarchical Hidden Markov Model: Analysis and Applications Machine Learning, 32:41–62 lationship between the occurance count of a state against the various models prediction accuracy A Krotov,...
- 8
- 528
- 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx
... comparative advantage E.g the price advantages of the small labs might be due to advantages of specialization Small labs generally offer a limited package of tests, which might enable them not to incur ... bound and compared to our capacity figures very low We have summarized the average and maximum testing capacity in appendix The ratio of the maximum capacity to the average capacity available is about ... understood and it incorporates all the relevant data However, there is no general standard for an acceptable level of price variability Thus, we had to fix a reasonable boundary The ratio mean to...
- 19
- 493
- 1
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... growth totally lacked organization (rhodamine– phalloidin staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these ... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... report a study of the activation of various Hsp90 clients and Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a and...
- 11
- 427
- 0
introduction to architectural science - the basis of sustainable design
... absorbers A cavity resonator absorber A perforated panel absorber Absorbent baffles in ducts Absorbent baffle between bathrooms An absorbent pelmet and a ventilator Absorbent lining of soffit and absorbent ... loss rate internal heat gain rate solar heat gain rate ventilation heat flow rate resistance air -to- air resistance cavity resistance radiation, radiated heat (from body) relative humidity surface ... strong advocacy of architectural regionalism and of designing in sympathy with the environment In many ways he can be considered as an important progenitor of what we now call ‘sustainable architecture’...
- 351
- 523
- 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... C*-ternary rings Taiwan J Math 13, 1985–1999 (2009) 11 Saadati, R, Vaezpour, M, Cho, Y: A note to paper “On the stability of cubic mappings and quartic mappings in random normed spaces” J Inequal Appl ... Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 184, 431–436 (1994) doi:10.1006/jmaa.1994.1211 Skof, F: Local properties and approximation of operators Rend Sem Mat Fis Milano ... and Y a complete non-Archimedean normed space Assume that |m| ≠1 Lemma 3.1 Let X and Y be linear normed spaces and f : X ® Y a mapping satisfying (1) Then f is an additive mapping Proof Letting...
- 14
- 479
- 0
Introduction to ARCHITECTURAL SCIENCE The Basis of Sustainable Design doc
... shadow-angle protractor Plan of a pair of vertical devices (fins) and their shading mask A horizontal device (a canopy) and its shading mask Relationship of ALT and VSA An egg-crate device and ... heat flow rate evaporative heat loss rate internal heat gain rate solar heat gain rate ventilation heat flow rate resistance air -to- air resistance cavity resistance radiation, radiated heat (from ... March) 1.4.1.2 Radiation calculations At any location and with respect to a surface of any orientation (ORI) and any tilt angle (TIL) the INC is continuously changing For any desired point in...
- 359
- 424
- 1
Báo cáo y học: "Self-reported asthma and allergies in top athletes compared to the general population - results of the German part of the GA2LEN-Olympic study 2008" pptx
... So far, no data on German top athletes are available Therefore, one aim of the study was to assess the prevalence of allergic and respiratory diseases and information about medical treatment in ... S, Marks G: Are the prevalence and treatment of astma similar in elite athletes and the age-matched non-athlete population? Scand J Med Sci Sports 2007, 17:623-627 Alaranta A, Alaranta H, Palmu ... asthma and allergies and to provide some insights in the quality of asthma surveillance in athletes and non-athletes Methods Study design and participants Within the framework of the Global Asthma...
- 6
- 467
- 0
Báo cáo khoa học: " Penetration of the English language in science: the case of a German national interdisciplinary critical care conference" docx
... clinicians, who elected to present their abstracts to a German-speaking audience in English, and second, because the German language, with its tradition and rich history in science as well as ... future of languages in science Competing interests There is a growing debate around the world about the rapid penetration of the English language into various expressions of human activity, including ... raising the international dissemination of German research: does changing publication language to English attract foreign authors to publish in a German basic psychology research journal? Exp Psychol...
- 2
- 481
- 0
A STUDY ON THE EFFECTS OF PRE-LISTENING ACTIVITIES ON LISTENING COMPREHENSION TASKS IN THE TRAINING PROGRAM TO NON-ENGLISH MAJOR STUDENTS OF GRADE 10 AT BAC NINH GIFTED HIGH SCHOOL
... reading and writing are important ways of gaining and consolidating information, vocabulary and structures in language learning, listening and speaking are the means of language communication ... attainable only by the interaction among participants; a mechanism for structuring and sequencing interaction, and a focus on meaning exchange It is also a language learning endeavor that requires ... to a unit of teaching/ learning activity which involves relevant instructional variables to be manipulated by the learners using some kind of data” (Rost 1990: 156) Language learning tasks are...
- 65
- 753
- 1
Using teacher-designed materials in teaching esp vocabulary to the second-year students of fashion designing at national university of art education difficulties and solutions
... because it is used as an international language in many areas such as: science and technology, business and commerce, international relations, diplomacy , etc Therefore, English teaching and learning ... teachers and students are well aware of the fact that vocabulary plays an important role in learning language especially in ESP learning because it is the element that links the four skills of speaking, ... that they cope with the lack of various teaching technique, the lack of teaching aids and reference materials Tomlinson (1998: 2) defined that “language teaching material is used to refer to anything...
- 10
- 647
- 3
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... discretion of the treating physician, and a variety of anaesthetic drugs are available to facilitate ETI Written guidelines for pre-hospital ETI were available in the Stavanger HEMS during the study ... type of airway device and drugs used to facilitate ETI, complications and the use of monitoring, including capnography We anonymised the involved HEMS physicians and recorded them as “anaesthesiologist...
- 6
- 611
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources to ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work ... multi-disciplinary team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among...
- 8
- 492
- 0
Tài liệu Mapping TOEFL® iBT Scores to the CEFR: An Application of Standard ... pdf
... feedback and discussion – Mean, median, min., max., standard deviation – Round includes task-level data—P+ values of candidates in bottom and top quartiles, and overall – Round includes percentage ... countries – Familiar with TOEFL®, English language instruction, learning and assessment, and the CEFR • Standard setting approaches – Performance-sample (Profile) approach for Writing and Speaking – ... Speaking: to 24 in one-point increments • Three rounds of judgments, with feedback and discussion – Mean, median, min., max., standard deviation – Round includes task-level data mean scores of candidates...
- 13
- 506
- 1
Tài liệu Performance effects of appointing other firms'''' executive directors to corporate boards: an analysis of UK firms ppt
... impact on the appointing company‟s performance Our empirical analysis is based on a new rich panel dataset that is obtained by merging financial data from Extel Financial and director information ... major sources First, financial data are drawn from the Extel Financial database The advantage of the database is 14 its use of consistent financial report information across a large number of ... 94(2), 291-309 Agrawal, A and Knoeber, C (1996) Firm performance and mechanisms to control agency problems between managers and shareholders, Journal of Financial and Quantitative Analysis, 31(3),...
- 36
- 396
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Hochstein P (1981) Uric acid provides an antioxidant defense in humans against oxidant- and radical-causing aging and cancer: a hypothesis Proc Natl Acad Sci USA 78, 6858–6862 FEBS Journal 276 ... (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria ... of mucosal epithelial tissues of all animals as part of the innate immune system [47] and is also thought to act as a microbicidal agent in these instances Because uric acid can easily permeate...
- 13
- 390
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... that MeMIH-B may act directly on the hepatopancreas and ovary to increase the rate of vitellogenin gene expression, indicating that both the hepatopancreas and ovary are the targets of MeMIH-B This ... using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq ... urea in binding buffer), sonicated, and agitated overnight at °C Following centrifugation as above, the supernatant was collected and loaded into an Ni2+–nitrilotriacetic acid–agarose (Qiagen,...
- 11
- 546
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25