effect of the endothelin a receptor antagonist lu 135252
Báo cáo y học: "Effect of the dual endothelin receptor antagonist bosentan on untreatable skin ulcers in a patient with diabetes: a case report" ppsx
... cause for the appearance of all ulcers and their resistance to standard therapy Although our patient had congestive heart failure and peripheral edema, these occurred six weeks after the appearance ... Congress of the International Diabetes Federation Authors’ contributions FAR diagnosed and treated the patient CLG and MBS reviewed the case All authors have read and approved the final manuscript ... bosentan therapy and two weeks’ treatment at a maintenance dose, with marked granulation tissue apparent on the heel (F) Complete healing of the ulcer was observed after a total of 21 weeks of bosentan...
- 4
- 337
- 0
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx
... nM of AF488-MCP-1 Since the internalization assay is to be used as a measure of pharmacodynamic effect of a CCR2 antagonist, it was also important to demonstrate the ability of the CCR2 antagonist ... experiments and drafted the manuscript AL carried out the assay in the clinical trials MG aided in the design of the experiments and review of the manuscript All authors read and approved the final manuscript ... (Table 5) In-study results This assay was used as a pharmacodynamic marker for biological activity of a CCR2 antagonist in a clinical trial consisting of 108 healthy individuals The data generated...
- 12
- 829
- 0
Báo cáo y học: "Effect of the Cannabinoid Receptor-1 antagonist SR141716A on human adipocyte inflammatory profile and differentiation" ppt
... TNF -a 5’- AACATCCAACCTTCCCAAACG -3’ 5’-FAM-CCCCCTCCTTCAGACACCCTCAACC -TAMRA-3’ 3’- CTCTTAACCCCCGAATCCCAG-5’ 5′-TCACCTCTTCAGAACGAATTGACA-3′ IL-6 5′-FAM-TACATCCTCGACGGCATCTCAGCCC -TAMRA-3′ 3′-AGTGCCTCTTTGCTGCTTTCAC-5′ ... 3′-AGTGCCTCTTTGCTGCTTTCAC-5′ 18S 5’- CGCCGCTAGAGGTGAAATTCT -3’ 5’-FAM- ACCGGCGCAAGACGGACCAGA -TAMRA-3’ 3’- CTTTCGTAAACGGTTCTTAC -5’ 5' -TGAAAGAAGTAGGAGTGGGCTTTG -3' A- FABP 5'-FAM-AGGAAAGTGGCTGGCATGGCCAA-TAMRA-3' ... Receptor- 1 antagonist SR14171 6A on human adipocyte inflammatory profile and differentiation Ravi Murumallaa, Karima Bencharifa, Lydie Gencea, Amrit Bhattacharyaa, Frank Talletb, Marie-Paule Gonthiera,...
- 38
- 555
- 0
Báo cáo y học: " Potent anti-inflammatory and antinociceptive activity of the endothelin receptor antagonist bosentan in monoarthritic mice" ppt
... endothelin receptor antagonists, we investigated the effects of systemic administration of the mixed ETA and ET B endothelin receptor antagonist bosentan and the ET A -selective antagonist ambrisentan ... elicit a response was read out in grams (g) Inhibition of mechanical hyperalgesia by dexamethasone Values in (b-e) are means ± standard error of the mean The results from two-way analysis of variance ... synovial membrane, the degree of synovial hyperplasia, and the extent of infiltration and fibrosis in the periarticular structures allowed grading of chronic inflammation The extent of damage of the...
- 9
- 224
- 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... evaluate the contribution of K88 and K13 to protein stabilization in the reaction with sulfate The far-UV and Soret CD spectra of the two mutants (not shown) reveal that the two variants and the ... increase of the absorbance band centered at 528 nm and by a blue-shift of the CT band from 618 to 616 nm (spectrum b of Fig 8A) The slow phase is instead characterized by a marked enhancement of the ... of the A- state A- state stability Figure shows the thermal denaturation profiles of the A- state of cytochrome c, as obtained from ellipticity values at 222 nm As previously observed for mononvalent...
- 11
- 487
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial ... oxidation rate A comparison with the auto-oxidation rate (data from Fig 3) revealed that in the presence of EDTA, the increase in the rate of oxidation of Hb A0 produced by the LPSs of rough and ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the...
- 6
- 748
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), ... developmental stages using the General Elute Mammalian TotalRNA kit (Sigma, Madrid, Spain) A 300 ng portion of each RNA extraction was DNAse treated (Promega, Madison, WI, USA) and reverse transcribed ... phylogenetic analysis The deduced primary structure of BgVgR was compared with VgRs of the cockroach P americana, the mosquitoes A aegypti, Anopheles gambiae, the fruit fly D melanogaster, and the ant...
- 11
- 414
- 0
Báo cáo y học: "First-dose analgesic effect of the cyclo-oxygenase-2 selective inhibitor lumiracoxib in osteoarthritis of the knee: a randomized, double-blind, placebo-controlled comparison with celecoxib [NCT00267215]" doc
... baseline and study end Statistical analysis The primary efficacy variable was the APID between the baseline pain assessment and the mean of the 3-hour and 5-hour actual pain assessments after the ... pain assessment phase of the study, the analgesic efficacy of a single dose of study medication was evaluated On the first day of treatment each patient rated actual pain intensity (100 mm VAS, ... included in the safety analysis PID was analysed using analysis of covariance (ANCOVA) The statistical fixed-effects model considered treatment and centre as main effects, whereas baseline actual...
- 9
- 423
- 0
Báo cáo y học: "Methotrexate enhances the anti-inflammatory effect of CF101 via up-regulation of the A3 adenosine receptor expression" doc
... Haemek (Haifa, Israel) The A3 AR antagonist MRS1523 was purchased from Sigma (St Louis, MO, USA) and diluted in the same manner as for CF101 Rabbit polyclonal antibodies against rat and human A3 AR ... designated the standard The blots were quantified by densitometric analysis and the ratio of RA patient/standard was calculated Blots of mitogen stimulated cells were quantified against β-actin The ... A3 AR as well as rat A2 AAR were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA, USA) MTX, PHA, adenosine and adenosine deaminase (ADA) were purchased from ABIC (Beit Shemesh, Israel)...
- 12
- 396
- 0
Báo cáo khoa hoc:"Effect of the slow (K) or rapid (k +) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn × brown egg type cross" ppsx
... weeks of age Plumage weight was calculated as an absolute value and per cent of body weight, as for males in individual cages 2.4 Statistical analysis Analysis of variance with unequal subclass ... Weight of feathers (g) % feathers 10.9 ± 9.1 1.1 ± 0.8 Weight of abdominal fat (g) % abdominal fat Analysis of variance Source of variation Significance per variable d.f Weight of feathers % feathers ... The analysis of variance (Tab III) and means of absolute values of plumage weight and per cent related to body weight did not show any significant effect of temperature on these variables at 10...
- 12
- 344
- 0
Báo cáo y học: "The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study" pot
... 18,485) Rate of progression Rate (95% CI) Values at RA duration Of years (onset)* Mean (95% CI) Values at RA duration of 10 years* Mean (95% CI) Values at RA duration of 20 years Mean (95% CI) HAQ ... income, and other patient outcomes [46-49] These measures incorporate RA activity, in particular RA pain, with cumulative RA effect and damage Bansback et al indicate that that the HAQ is the ‘primary ... 0.749) Variable Effect of biologic therapy on annual rates of progression of disability, loss of health status, and costs in patients prior to and after the start of biologic therapy in RA All, all...
- 12
- 385
- 0
Báo cáo y học: " Role of the tachykinin NK1 receptor in a murine model of cigarette smoke-induced pulmonary inflammation" docx
... emphysema Emphysema is a structural disorder characterized by damage to the lung parenchyma The destruction of the alveolar walls will lead to enlargement of the alveolar airspaces The alveolar airspace ... in BAL fluid after 24 weeks of CS-exposure Statistical analysis All results are reported as mean ± standard error of the mean (SEM) Statistical analysis was performed with Sigma Stat software ... coordination of the study, gathered the data on BAL and lung inflammation, interpreted the data and drafted the manuscript KB quantified the inflammatory mediators, lymphoid follicles and MMP-12...
- 12
- 344
- 0
Báo cáo khoa học: " Modeling effect of the septic condition and trauma on C-reactive protein levels in children with sepsis: a retrospective study" pdf
... Moreira A, Fernandes R, Mealha A, Aragao A, Sabino H: C-reactive protein as an indicator of sepsis Intensive Care Med 1998, 24:1052-1056 Benitz WE, Han MY, Madan A, Ramachandra P: Serial serum Creactive ... diagnostic group For more detailed insight into the data, the mean age (standard deviation) and clinical diagnoses of nonsurgical patients according to the group analyzed are summarized in Tables ... well as with time, we can conclude that the effect of surgical diagnosis is, on a logarithmic scale, approximately the same for each septic category and over time The magnitude of this additional...
- 9
- 456
- 0
Báo cáo y học: "Characterizing the expression of the human olfactory receptor gene family using a novel DNA microarray" pps
... Additional data file is a table of RMA values (in log scale) for all probe sets from all hybridizations Additional table is a figure of the RT-PCR validation of the microarray results Additional data ... standardized to have mean and standard deviation and are color coded (red and blue shades indicate values above and below the mean, respectively) The dendrograms on top of each panel illustrate ... reciprocal best hits were obtained using two-way blastp [44] searches of Additional data files The following additional data are available with the online version of this paper Additional data file...
- 10
- 261
- 0
VCM 2012 12 Một phương pháp đánh giá về ảnh hưởng của bộ lọc đến hình dạng tín hiệu điện tim A method evaluates an effect of the filter to ECG signal
... Discrete Wavelet Transform for Quality Diagnosis of Biomedical ECG Signal, International Journal of Computer Applications, 2011 [7] Mikhled Alfaouri and Khaled Daqrouq, ECG Signal Denoising By Wavelet ... Science and Engineering, 2011 [5] Wan-hua Lin, Mico Yee-Man Wong, Li-na Pu, Yuan-ting Zhang, “Comparison of Median Filter and Discrete Dyadic Wavelet Transform for Noise Cancellation in Electrocardiogram”, ... Electrocardiogram”, 32nd Annual International Conference of the IEEE EMBS Buenos Aires, Argentina, August 31 - September 4, 2010 Mã bài: 20 82 [6] Ramesh D Mali, Dr U.L Bombale, Removal of 50Hz PLI...
- 8
- 465
- 1
Báo cáo khoa học: " Effect of the medical emergency team on long-term mortality following major surgery"
... patients, including rapid stabilization of vital parameters, physical and neurological examination, radiography and laboratory analysis Patients on catecholamines upon arrival showed clinical ... distance tertiary air transfer and triage at Cologne-Bonn Military Airport Detailed information on triage and initial care in the disaster region [8,9] and medical aspects associated with the airlift ... Alcaligenes xylooxidans, E faecalis and faecium, K pneumoniae, MRSA and S maltophilia from the respiratory tract, Candida species and E faecium from blood cultures, and E faecium and A fumigatus...
- 9
- 761
- 0
Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"
... conducting data analysis and writing the manuscript Abbreviations AKBA: 3-O-acetyl-11-keto-beta-boswellic acid; ANOVA: analysis of variance; ASRAM: Alluri Sitarama Raju Academy of Medical Sciences; ... Krishnaraju AV, Sundararaju D, Vamsikrishna U, Suryachandra R, Machiraju G, Sengupta K and Trimurtulu G Safety and Toxicological Evaluation of Aflapin®: a Novel Boswellia- Derived Anti-inflammatory ... Atal CK Pharmacology of an extract of salai guggal ex-Boswellia serrata, a new non-steroidal anti-inflammatory agent Agents Actions 1986; 18: 407-412 Ethan B, Heather B, Theresa DH, Ivo F, Sadaf...
- 12
- 606
- 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... clinical trial evaluated the safety and efficacy of UC-II in the treatment of the knee in OA patients Materials and Methods Study Design This clinical trial (Human Clinical Trial Approval #06UOHI) ... analyzed by MDS Laboratory Services (London, Ontario, Canada) Appropriateness of Measurements The efficacy and safety assessments used in this study were standard for OA and are widely used and ... comparisons between the UC-II and G+C groups were made at each visit using analysis of variance, using the baseline visit as a covariate SAS version 9.1 has been used to perform the statistical analysis...
- 10
- 706
- 0
EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE
... reaction, ∆Η , due to a lack of data Therefore, the nutritional energy of the DF about 3500 kcal/kg-DF was assumed as the enthalpy of the reaction Table summarizes the estimated values of the ... 7-13 Nagasaki K., Akakura N and Atsumi K (199 8a) Degradation Patterns of Organic Material in Batch and Fed-batch composting operations, Waste Management & Research, 16 (5), 484-489 Nakasaki, K., ... between the temperature profiles Therefore, the composting rate may be estimated on the basis of a simple heat balance The variation of the bed temperature under the steady state condition may be...
- 8
- 622
- 1
Effect of the presence of coexisting substances on UV inactivation of Cryptosporidium parvum oocysts
... in Japan Wat Res., 36, 519-526 Hirata T., Chikuma D., Shimura A. , Hashimoto A. , Motoyama N., Takahashi K., Moniwa T., Kaneko M., Saito S and Maede S (2000) Effects of ozonation and chlorination ... excystation and animal infectivity assays MATERIALS AND METHODS Cryptosporidium parvum oocysts The C parvum HNJ-1 strain (human isolate by Dr Iseki, Kanazawa University, Japan) that was passaged in ... 161-167 Morita S., Namikoshi A. , Hirata T., Oguma K., Katayama H., Ohgaki S., Motoyama N and Fujiwara M (2002) Efficacy of UV irradiation in inactivating Cryptosporidium parvum oocysts Appl Environ...
- 8
- 358
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25