early studies on bioequivalence of dietary synthetic beta carotene to vitamin a in humans
Báo cáo hóa học: " Studies on Preparation of Photosensitizer Loaded Magnetic Silica Nanoparticles and Their Anti-Tumor Effects for Targeting Photodynamic Therap" ppt
Ngày tải lên :
22/06/2014, 01:20
... determined by MTT assay as mentioned above Statistical Analysis Cell viability was calculated using the following formula: average A value of experimental group/average A value of control group 100% ... estimated by the typical equation Figure shows a concentration-dependent increase in photoluminescence signal, demonstrating the encapsulation of the PHPP again Encapsulation Efficiency Measurements ... demonstrated slight effects on DNA Biosafety Assessment Biosafety assessment was essential to evaluate the potential application of silica nanoparticle in clinics Here, MTT assay was performed to...
- 9
- 317
- 0
Báo cáo khoa học: "Effects of Combination Dietary Conjugated Linoleic Acid with Vitamin A (Retinol) and Selenium on the Response of the Immunoglobulin Productivity in Mice" pdf
Ngày tải lên :
07/08/2014, 17:22
... dietary CLA may be achieved via regulation of IL-2 and PGE2 production [13, 25] A large number of reports have appeared showing the inhibitory or stimulatory effects of retinoid (vitamin A) on ... transferred to the microfuge tube Measurement of secretory IgA concentration was done by the sandwich ELISA [8,32] S tatis tica l an a ly sis Data were analysed by one-way analysis of variance followed ... feeding Vitamin A at 300 IU/kg/day was given as ADE complex (D, 100 IU/kg/day; E, mg/kg/day) and selenium at ㎍/kg/day [23] Vitamin E and D were used as antioxidants and supplements to vitamin A...
- 6
- 344
- 0
báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc
Ngày tải lên :
18/06/2014, 19:20
... separated from the questionnaires in order to assure confidentiality Based on sociodemographics out of routine claims data of the statutory health insurance we performed a nonresponder analysis ... asymptomatic but important risk factor Chronic conditions and multimorbidity are an important and increasing challenge for GPs So far most studies focussed on the impact of one condition on QoL As ... because of a so called labelling effect [31] Wee et al assumed that there are chronic conditions with non-additional effects on health related QoL, so that having both conditions is not more disabling...
- 7
- 458
- 0
Báo cáo hóa học: " Optimization, Yield Studies and Morphology of WO3 Nano-Wires Synthesized by Laser Pyrolysis in C2H2 and O2 Ambients— Validation of a New Growth Mechanism" pdf
Ngày tải lên :
22/06/2014, 01:20
... one-dimensional to spherical particles is also possible at suitable annealing conditions For instance, nano-belts of Zn acetate were converted into aggregates of ZnO nanoparticles as reported in this ... due to the prior -to- SEM coating to improve imaging The absence of catalysts in addition to the analysis of the nano-wire length-anddiameter data has validated a new growth mechanism, which we have ... a stream of very fine droplets of a precursor solution into an infrared laser beam and depositing the resulting aerosol onto a Corning glass substrate A wavelength tuneable continuous wave (cw)...
- 9
- 310
- 0
Báo cáo hóa học: " Research Article Remarks on Separation of Convex Sets, Fixed-Point Theorem, and Applications in Theory of Linear Operators" pot
Ngày tải lên :
22/06/2014, 19:20
... certain properties of continuous linear operators acting in a reflexive Banach space, and obtain conditions under which such operator has an eigenvector (clearly this implies that the operator has ... a result about existence of an invariant subspace of a linear bounded operator without using a completely continuous operator Remarks on the separation of convex sets in a Banach space We will ... compact operator in the case of an arbitrary Banach space Some remarks on existence of the invariant subspace Let X be a Banach space such as above and A ∈ B(X), and let BA (X) be a subset of...
- 14
- 314
- 0
Báo cáo y học: "The impact of socio-economic disadvantage on rates of hospital separations for diabetes-related foot disease in Victoria, Australia" pdf
Ngày tải lên :
10/08/2014, 21:24
... areas at most disadvantage A decile of 10 indicates those areas in the top 10% of the state which are areas of least disadvantage Page of In order to allocate a rank under IRSD, the Australian ... more, smaller geographic areas known as Statistical Local Areas Regions or Statistical Local Areas incorporated into a single LGA may change over time and boundaries that define each LGA may also ... disadvantage for each individual within that area Once each LGA had been ranked according to the 2006 IRSD allocation, all LGAs with an index of or (most disadvantaged) and those with an index of...
- 7
- 351
- 0
Studies on the intracellular signalling pathways triggered by the anaphylatoxin c5a in human phagocytic cells 1
Ngày tải lên :
14/09/2015, 21:55
... common pathway triggered upon cytokine binding is the JAK/STAT pathway Binding of the cytokine to its receptor activates the enzyme Janus Kinase (JAK), eventually leading to the activation of transcription ... Melendez AJ Sphingosine Kinase mediates intracellular Ca2+ release, degranulation, cytokine production and chemotaxis in response to anaphylatoxins Abstract accepted for poster presentation at the ... features of an acute inflammatory response In this instance, local dilation of blood vessels causes stress on the endothelial lining at the inflammatory site, allowing exudation of blood plasma...
- 79
- 229
- 0
effects of chitosan on flocculation of chaetoceros algae and ability to apply on blood cockle (anadara granosa) and white leg shrimp (litopenaeus vannamei) rearing
Ngày tải lên :
18/09/2015, 00:21
... harvesting methods and preservation on the quality of Chaetoceros Master thesis Can Tho university Abstract Ravi Divakaran and V.N Sivasankara Pillai, 2001 Flocculation of algae using chitosan School ... THU THAO Can Tho, December 2014 EFFECTS OF CHITOSAN ON FLOCCULATION OF CHAETOCEROS ALGAE AND ABILITY TO APPLY FOR REARING BLOOD COCKLE (Anadara granosa) AND WHITE LEG SHRIMP (Litopenaeus vannamei) ... density of algae was determined the density times a week to assess filtration rate before and after feeding Statistical analysis: data were analyzed for mean value, standard deviation by using Excel...
- 15
- 370
- 0
Purification and studies on natural cellulase properties and produce recombinant cellulase from fungus in vietnam
Ngày tải lên :
04/02/2016, 10:18
... tactctaactctggcgttacatttaacaagaagctcgtgagtgatgtatcaagcatcccc Y S N S G V T F N K K L V S D V S S I P acctcggtggaatggaagcaggacaacaccaacgtcaacgccgatgtcgcgtatgatctt T S V E W K Q D N T N V N A D V A ... ttcaccgcggcgaatgtggaccatgccacttctagcggcgactatgaactgatgatttgg F T A A N V D H A T S S G D Y E L M I W cttgcccgctacggcaacatccagcccattggcaagcaaattgccacggccacagtggga L A R Y G N I Q P I G K Q I A ... I G K Q I A T A T V G ggcaagtcctgggaggtgtggtatggcagcaccacccaggccggtgcggagcagaggaca G K S W E V W Y G S T T Q A G A E Q R T tacagctttgtgtcggaaagccctatcaactcatacagtggggacatcaatgcatttttc Y S F V...
- 27
- 286
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
Ngày tải lên :
14/02/2014, 22:20
... present a method based on dynamic modelling that allows for the quantification and visualization of cellular rates of metabolite interconversion during an acclimation process incorporating environmental ... identification and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential ... assessment of the trajectory of interconversion rates as a function of time of cold exposure, (b) comparison of the magnitudes of the various interconversion rates, and (c) lineup of the accessions...
- 13
- 707
- 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
Ngày tải lên :
18/02/2014, 11:20
... lm ATP in the phosphorylation reaction mix, we could obtain a similar extent of phosphorylation to that obtained at an ATP concentration of 200 lm (Fig 4A) The stoichiometry of phosphorylation ... phosphate, HSL bands were excised from the gel and placed in scintillation vials containing 10 mL of scintillation liquid and quantified on a scintillation counter (Wallac 1414 liquid scintillation ... concentrations tested Owing to the interaction between bis-ANS and ATP, the binding assay provided only reliable performance in a short range of the bis-ANS concentrations tested in Fig 2, and...
- 11
- 562
- 0
Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt
Ngày tải lên :
18/02/2014, 18:20
... corresponding control indicating that LPS induces ICAM-1 expression in SCs, suggest that ICAM-1 may play a role in the focal accumulation and antigen-induced activation of T cells in inflammatory ... endothelium and migration of lymphocytes towards in ammatory sites [35,36] SCs have been implicated in human in ammatory demyelinating neuropathies such as ´ Guillain–Barre syndrome and chronic in ammatory ... immune and in ammatory responses [24,25] Mitogen-activated protein kinases (MAPKs) are important mediators of cytokine expression; in particular, p38 and extracellular signal-regulated kinase (ERK)...
- 11
- 519
- 0
Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot
Ngày tải lên :
07/03/2014, 01:20
... with alanine in GST–hsMOK2 constructs Incubation of these fusion proteins with recombinant Aurora A revealed a minor reduction in phosphorylation of the mutant containing only the S14 6A mutation ... cellular localization of hsMOK2 into nuclear aggregates induced by pathogenic lamin A and C mutant proteins These results indicated that pathogenic mutations in lamin A ⁄ C lead to sequestration of hsMOK2 ... following activation of kinases such as PKA in response to various signaling pathways In addition, Aurora A kinase is specifically activated before mitosis [25,26] Mitotic nuclear envelope breakdown...
- 11
- 378
- 0
Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot
Ngày tải lên :
08/03/2014, 23:20
... USA Bistris was obtained from Nacalai Tesque, Kyoto, Japan All other chemicals were of reagent grade and obtained locally Strains and plasmid DNA The plasmid pTSY3 containing the PRC1 gene coding ... Murata, K & Kimura, A (1983) Transformation of intact yeast cells treated with alkali cations J Bacteriol 153, 163–168 16 Hanahan, D (1983) Studies on transformation of Escherichia coli with plasmids ... DISCUSSION Effect of replacement of Cys341 on kinetic constants The introduction of Gly at position 341 would be expected to reduce any structural constraints at the S1 subsite because of elimination...
- 6
- 459
- 0
Seminar: Sumary of the book “5 Steps to Speak A Language” doc
Ngày tải lên :
09/03/2014, 07:20
... sentence we are pronouncing, which is referred to as intonation If the stressing of sounds is wrong, the intonation then will be different Intonation creates the melody of a language Intonation of sentences ... traces and marks then form something like a “language map” in your brain After gaining some understanding of the human brain, linguists conducted further research on the various ways to approach ... form of writing and speaking Several years ago, I joined an English class taught by a teacher who was a native speaker of the language She was focusing on making the students talk to each other in...
- 44
- 574
- 0
Báo cáo khoa học: Binding of non-natural 3¢-nucleotides to ribonuclease A ppt
Ngày tải lên :
16/03/2014, 18:20
... effective antisense agents [40] In addition, the antineoplastic drug fludarabine is an arabinonucleoside, and the antineoplastic drug clofarabine is a 2¢-fluoro-2¢-deoxyarabinonucleoside We find that araUMP ... contribution of noncatalytic phosphate-binding subsites to the mechanism of bovine pancreatic ribonuclease A Cell Mol Life Sci 54, 766–774 31 Altona C & Sundaralingam M (1972) Conformational analysis of ... T45G variant leads to a much broader range in affinity (Table 1) New applications have emerged for arabinonucleosides For example, Dharma and coworkers have demonstrated that arabinonucleotides are...
- 12
- 576
- 0
What kind of advice should you listen to? building a desire engine pdf
Ngày tải lên :
28/06/2014, 17:20
... @nireyal NirAndFar.com Habit-forming technology Pleasure seeking Pain alleviation Vitamin Painkiller @nireyal NirAndFar.com Creating pain? (more of an itch) @nireyal NirAndFar.com @nireyal NirAndFar.com ... @nireyal NirAndFar.com Trigger Examples External Alarms Advertising Calls -to- action Emails Stores Emotions Routines Situations Places People What to next is in the trigger @nireyal Internal What to ... Behavior @nireyal Sensation Anticipation Social Cohesion Seek: Pleasure Hope Acceptance Avoid: Pain Fear Rejection NirAndFar.com Factors of ability Time Money Physical effort Brain cycles Social...
- 82
- 313
- 0
Báo cáo toán học: "Extremal subsets of {1, ..., n} avoiding solutions to linear equations in three variables" doc
Ngày tải lên :
07/08/2014, 15:23
... extra properties, though some of our initial observations also apply in the inhomogeneous setting We shall also employ the concise formulation A avoids L’ to indicate that a set A of positive integers ... then an L-avoiding set of type II in the introduction The crucial observation is the direct generalisation of Lemma 2(b) in [1] : because of its importance and because an apparently awkward technicality ... linear equations, J Number Theory 102 (2003), 11-22 [10] I.Z Ruzsa, Solving a linear equation in a set of integers I, Acta Arith 65 (1993), 259-282 [11] I.Z Ruzsa, Solving a linear equation in...
- 22
- 348
- 0
Báo cáo khoa học: "Changes of biomarkers with oral exposure to benzo(a)pyrene, phenanthrene and pyrene in rats" ppt
Ngày tải lên :
07/08/2014, 20:23
... Chemicals were treated for 30 days via gavages to week old female SD rats Values are the mean ± SD (n = 3) ALT: alanine aminotransferase, AST: aspartate aminotransferase, ALP: alkaline phosphatase ... Bioavailability of PCBs to male laboratory rats maintained on litters of contaminated soils: PCB burden and induction of alkoxyresorufin O-dealkylase activities in liver and lung Arch Environ Contam ... biochemical parameters in serum Alanine aminotransferase (ALT), aspirate aminotransferase (AST) and alkaline phosphatase (ALP) in serum were determined using a commercial kit (Bayer, Germany) and a blood...
- 8
- 245
- 0
Báo cáo khoa học: " Identification of PCR-based markers linked to wood splitting in Eucalyptus grandis" pdf
Ngày tải lên :
08/08/2014, 14:20
... the resulting bands were scored on a scale ranging from to according to the intensity of the bands A score of represented the absence of a band and a score of a very dark band In addition the bulked ... This increases the chances of finding fragments that are linked to more than one gene A large number of fragments have to be screened and a large number of models have to be tested to increase ... trial was used as a verification trial and the individuals were selected by means of forward selection where individuals are evaluated based on their own performance A total of 21 high splitting...
- 4
- 460
- 0