each swapdepths method is associated with a startdrag action when you click puzzle1 it swaps with puzzle2 when you click puzzle2 it swaps with puzzle1
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
Ngày tải lên :
26/10/2012, 10:04
... 5’- AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... et al reported that BNP levels increased with age, and were higher in females than males among subjects with no known cardiovascular or detectable structural heart disease [18] Maffei et al reported...
- 7
- 612
- 1
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
Ngày tải lên :
23/03/2014, 09:20
... vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by thrombin and Fx proteases at an ... (Axon Instruments, Union City, CA, USA) Data were sampled at 10 kHz and ltered at kHz Data acquisition was controlled by a Macintosh PPC 7100 80 computer, equipped with ITC-16 analog digital ... Navs was thus far obtained mainly from mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal...
- 14
- 206
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
Ngày tải lên :
29/03/2014, 00:20
... cyclosporin-insensitive permeability transition pore in yeast mitochondria J Biol Chem, 272, 21104– 21112 Yamada A, Yamamoto T, Yoshimura Y, Gouda S, Kawashima S, Yamazaki N, Yamashita K, Kataoka M, Nagata T, ... mentioned above, BKA was without an effect on Ca2+ uptake rate and capacity in Artemia mitochondria Atypical Artemia ANT Fig Effect of Ca2+ uptake on light scattering in mitochondria isolated from ... static, assisting the reliable calculations of the total amount of CaCl2 added What is apparent from Fig 1A, B is that both ADP and ATP significantly decreased Ca2+ uptake rates as compared with...
- 15
- 505
- 0
Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot
Ngày tải lên :
29/03/2014, 09:20
... analyses with antibodies against PMCA, as a marker for the cell membrane, and extracellular signalregulated kinase ⁄ (ERK1 ⁄ 2), as a marker for the cytosolic fraction, showed that cell fractionation ... concentrations are associated with significant changes in blood pressure [6] The GC -A receptor consists of an extracellular ligand-binding domain of approximately 441 amino acids (aa), a short membrane-spanning ... Guanylyl cyclase activity X-fold vs maximal activity A * 0.8 GC -A S487E all n = 0.4 0.2 GC -A 0.0 Basal 0.1 Guanylyl cyclase activity X-fold vs maximal activity B wt GC -A * 0.6 0.7 10 100 nM ANP * 0.6...
- 14
- 313
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
Ngày tải lên :
18/06/2014, 15:20
... done with an initial 20 sec denaturation at 95°C, followed by an 60 sec annealing at 50°C and a final ramp to 85°C with continuous fluorescence acquisition at a transition rate of 0.1°C/sec Additionally, ... were associated with survival of severe sepsis when analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal ... Cerami A, Bucala R: MIF is a pituitary-derived cytokine that potentiates lethal endotoxaemia Nature 1993, 365:756-759 Calandra T, Bernhagen J, Mitchell RA, Bucala R: The macrophage is an important...
- 8
- 554
- 0
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
Ngày tải lên :
18/06/2014, 16:20
... study and helped draft the manuscript MAK assisted with the data collection and helped draft the manuscript IBJ assisted with the statistical analysis JM assisted with data collection and helped ... (cisplatin or carboplatin) and taxane [3] Despite an initial response to cisplatin treatment, many patients with EOC develop resistance to the drug and relapse within a few years [4] Cisplatin ... draft the manuscript JB assisted with collection of clinical data MU assisted with data collection and participated in its design FP assisted with data collection and helped to draft the manuscript...
- 12
- 531
- 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc
Ngày tải lên :
18/06/2014, 16:20
... Takeo S, Harada T, Okazawa T, Yanai H, Okita K: Matrix metalloproteinase-7 and matrix metalloproteinase-9 are associated with unfavourable prognosis in superficial oesophageal cancer Br J Cancer ... this article as: Grimm et al.: MMP-1 is a (pre-)invasive factor in Barrett -associated esophageal adenocarcinomas and is associated with positive lymph node status Journal of Translational Medicine ... esophageal squamous epithelium MMP-1 expression in stromal cells was considerably weak and strongly associated with high-grade and low-grade intraepithelial neoplasia within Barrett’s mucosa as...
- 11
- 647
- 0
Báo cáo sinh học: " Codon usage in vertebrates is associated with a low risk of acquiring nonsense mutations" doc
Ngày tải lên :
18/06/2014, 19:20
... the analysis software; WAF and PS analyzed and interpreted the data, and wrote the manuscript Both authors read and approved the final manuscript Schmid and Flegel Journal of Translational Medicine ... Table S3 CDS analysis data Table S4 Whole genome analysis data Table S5 GC content and risk score ω of the 61 codons Acknowledgements and Funding We acknowledge the discussions with Franz F Wagner ... feature in the 30 examined non-vertebrates A low risk of acquiring nonsense mutations may have Page of advantages for organisms with relatively long lifespans and small numbers of offspring Calculating...
- 7
- 437
- 0
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
Ngày tải lên :
18/06/2014, 19:20
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... changes that characterize prostate cancer progression Cancer Res 2001, 61:2212-2219 Sakakura C, Hagiwara A, Yasuoka R, Fujita Y, Nakanishi M, Masuda K, Shimomura K, Nakamura Y, Inazawa J, Abe ... clinical samples, follow-up clinical information and final writing of the manuscript VM, SS, PC and EB participated in acquiring clinical and laboratory data, data analysis and data interpretation...
- 6
- 300
- 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
Ngày tải lên :
18/06/2014, 22:20
... clinicopathological parameters/survival of HNSCC patients were also analyzed Materials and methods Page of 10 Virginia Cancer Registry Material was obtained with appropriate human protection approvals from ... Her2, and Her3, is a potent target for antitumor strategies as it plays a critical role in HNSCC tumor cell growth, survival, invasion, metastasis and angiogenesis Numerous pharmaceutical approaches ... Program, Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA 2Applied Molecular Pathology Laboratory, Laboratory of Pathology, National Cancer...
- 10
- 490
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
Ngày tải lên :
19/06/2014, 08:20
... those relating to agonist-antagonist muscle pairs A single suprathreshold pulse of Transcranial Magnetic Stimulation (TMS) over the hand area of M1 results in a balance of inhibitory and excitatory ... cortical inhibition [28,37] These transient changes in excitability can lead to sustained, cumulative changes, and are associated with motor learning [19] Interventions such as transcranial direct ... behaviorally driven functional plasticity is a characteristic feature of motor cortex, and that motor behaviour associated with skill learning is crucial in shaping the functional organization of M1 [27],...
- 8
- 432
- 0
báo cáo hóa học: " Too much or too little step width variability is associated with a fall history in older persons who walk at or near normal gait speed" pdf
Ngày tải lên :
19/06/2014, 10:20
... others have shown an association with similar gait characteristics[13,17] One potential explanation may be the way the gait characteristics were measured in this study Gait variability was calculated ... Journal of NeuroEngineering and Rehabilitation 2005, 2:21 Background Variability of gait can be quantified using both temporal and spatial gait characteristics Variability of temporal characteristics ... situation is to have a moderate amount of variability We discovered that not only having too little step width variability but also having too much step width variability was associated with a history...
- 8
- 402
- 0
Báo cáo hóa học: " A predominance of R5-like HIV genotypes in vaginal secretions is associated with elevated plasma HIV-1 RNA levels and the absence of anti-retroviral therapy" docx
Ngày tải lên :
20/06/2014, 01:20
... conducted HTA analyses, participated in PCR sample preparation, carried out data analysis, and drafted the manuscript PK participated in the study design and conducted the statistical analyses RC participated ... plasma and vaginal compartments was observed in this cohort, 50 to × 105 copies/mL plasma and 50 to × 105 copies/vaginal sample For statistical analysis, HIV RNA levels in both plasma and vaginal ... viral and clinical factors associated with vaginal X4- or R5-like genotypes, we evaluated plasma and vaginal viral levels, ART use, and CD4+ T lymphoctye counts using Chi-square and Fisher's exact...
- 4
- 481
- 0
o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx
Ngày tải lên :
20/06/2014, 04:20
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... changes that characterize prostate cancer progression Cancer Res 2001, 61:2212-2219 Sakakura C, Hagiwara A, Yasuoka R, Fujita Y, Nakanishi M, Masuda K, Shimomura K, Nakamura Y, Inazawa J, Abe ... clinical samples, follow-up clinical information and final writing of the manuscript VM, SS, PC and EB participated in acquiring clinical and laboratory data, data analysis and data interpretation...
- 6
- 312
- 0
báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc
Ngày tải lên :
20/06/2014, 04:20
... clinicopathological parameters/survival of HNSCC patients were also analyzed Materials and methods Page of 10 Virginia Cancer Registry Material was obtained with appropriate human protection approvals from ... Her2, and Her3, is a potent target for antitumor strategies as it plays a critical role in HNSCC tumor cell growth, survival, invasion, metastasis and angiogenesis Numerous pharmaceutical approaches ... Program, Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA 2Applied Molecular Pathology Laboratory, Laboratory of Pathology, National Cancer...
- 10
- 479
- 0
báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx
Ngày tải lên :
20/06/2014, 07:20
... necrosis factor-related apoptosis-inducing ligand is associated with favourable ovarian cancer survival Clin Cancer Res 2003, 9:762-766 Kayagaki N, Yamaguchi N, Nakayama M, Takeda K, Akiba H, ... paclitaxel IC50 was observed only with OVC346, OVC488 and OVC509 ascites Ovarian cancer ascites OVC432 had little anti-apoptotic activity against cisplatin, paclitaxel and TRAIL These data demonstrate ... ovarian cancer and treated with increasing concentrations of TRAIL for 48 h or with cisplatin or paclitaxel for 72 h Cell viability was assessed by XTT assays TRAIL, cisplatin and paclitaxel...
- 10
- 383
- 0
báo cáo hóa học:" Elevated osteoprotegerin is associated with abnormal ankle brachial indices in patients infected with HIV: a cross-sectional study" pptx
Ngày tải lên :
20/06/2014, 08:20
... approximately 44% of our cohort had ABIs that put them at significant risk for cardiovascular events and mortality PAD is strongly associated with traditional cardiovascular risk factors, such as advanced ... cerebrovascular disease was defined as a history of transient ischemic attack, ischemic or hemorrhagic stroke The diagnosis of PAD was based on a history of abnormal ABIs, percutaneous peripheral arterial ... (including PAD), acute coronary syndrome, and cardiovascular mortality [19,33] Although inflammatory markers, such as CRP, IL-1b, and IL-6, are associated with cardiovascular diseases, OPG is a unique...
- 6
- 381
- 0
Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc
Ngày tải lên :
09/08/2014, 07:20
... that FCGR 3A- 158V/F functional polymorphisms were associated with RA among anti-GPI antibody positive individuals This is the first report on possible mechanisms of arthritic diseases; they are ... AF, Emery P, Isaacs JD: Fcgamma receptor type IIIA is associated with rheumatoid arthritis in two distinct ethnic groups Arthritis Rheum 2000, 43:2328-2334 Morgan AW, Keyte VH, Babbage SJ, Robinson ... DA, McShane DJ, Fries JF, Cooper NS, Healey LA, Kaplan SR, Liang MH, Luthra HS, et al.: The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis...
- 6
- 414
- 0
Báo cáo y học: "Adalimumab clinical efficacy is associated with rheumatoid factor and anti-cyclic citrullinated peptide antibody titer reduction: a one-year prospective study" potx
Ngày tải lên :
09/08/2014, 07:20
... of ANA in patients treated with adalimumab At baseline, of 57 (7%) adalimumab-treated patients with RA, and of 55 (9%) methotrexate-treated patients with RA tested positive for ANA (Table 5) After ... statistically significant Data were analyzed with SPSS statistical software 10.00 for Windows (SPSS, Inc, Chicago, IL, USA) Statistical analysis was calculated by Last Observation Carried Forward ... display a more active disease associated with a higher response to therapy in comparison with patients negative for anti-CCP autoantibodies This finding might explain, at least in part, the association...
- 8
- 762
- 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
Ngày tải lên :
09/08/2014, 07:20
... GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB ... FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGATCAC SNP5 allele1 ... SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 VIC-CTGCCAACTCTGGCTG-MGB SNP12R TCTTCCCGAAGCTGTGTAGACT SNP12 allele2 FAM- CCAACGCTGGCTG-MGB...
- 9
- 559
- 0