each heading and subheading should have parallel structure if the first heading is a noun the second heading should be a noun

pariah politics understanding western islamist extremism and what should be done jan 2009

pariah politics understanding western islamist extremism and what should be done jan 2009

Ngày tải lên : 11/06/2014, 00:28
... Norbert Mao (Uganda), Emilia Beblava (Slovakia), Kamala Chandrakirana (Indonesia), Hoda Elsadda (Egypt), Hiddo Houben (the Netherlands), Brian Kagoro (Zimbabwe), Raenette Taljaard (South Africa), and ... a quantifiable manner so that this can be evaluated alongside evidence about the role played by human and social capital Once aggregated together, this analysis amounts to an analytical foundation ... American Values: The Challenge at Home and Abroad’, in Strobe Talbott and Nayan Chanda (eds.), The Age of Terror: America and the World after September 11 (2001); Klausen, K., The Islamic Challenge:...
  • 389
  • 393
  • 0
Criteria: Official written policies and procedures should be documented for all of the Supervisor’s accounting information systems potx

Criteria: Official written policies and procedures should be documented for all of the Supervisor’s accounting information systems potx

Ngày tải lên : 20/06/2014, 03:20
... timely and accurate bank reconciliations are key to effective internal accounting and administrative controls, the ability to maintain the timeliness of the reconciliations was hampered by the increased ... quarter of the fiscal year Cause: Lack of adherence to the existing administrative and internal accounting controls Effect: Lack of timely review may prevent the detection of misstatements in the ... in the event of a major disaster such as a hurricane Recommendation: It is recommended that the Palm Beach County Supervisor of Elections Obtain an independent third party solution such as a bank...
  • 10
  • 367
  • 0
Báo cáo y học: " Models of epidemics: when contact repetition and clustering should be included" pps

Báo cáo y học: " Models of epidemics: when contact repetition and clustering should be included" pps

Ngày tải lên : 13/08/2014, 16:21
... M, Olango J, Onek P, Turyanika J, Mutyaba I, Luwaga HRS, Bisoborwa G, Kaguna A, Omaswa FG, Zaramba S, Okware S, Opio A, Amandua J, Kamugisha J, Mukoyo E, Wanyana J, Mugero C, Lamunu M, Mugaga M, ... This paper simplifies these complex patterns to a manageable model and parameter space that can be investigated systematically Our research applies to diseases transmitted via conversational ... both variables can be obtained when R0 estimates are available and when the possible pathways of transmission are known, because β and n are linked to the basic reproduction number by R0,ran =...
  • 15
  • 231
  • 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Ngày tải lên : 30/03/2014, 10:20
... b-strands (bA to bF) and two a- helices (aA and aB) (Fig 4) The structure of the C378G variant of SAP97PDZ2 was practically identical to that of C378S variant, except for the mutated residue, and because ... crystallographic analysis shows a canonical class I interaction between SAP97PDZ2 and GluR -A1 8 peptide The discrepancy between the relative scarcity of interactions in the complex structure and the ... the complex as an extended b-strand sandwiched between aB and bB and antiparallel to the b-strand (Fig 6A) The terminal carboxylate group of Leu907 forms hydrogen bonds with main chain amide nitrogens...
  • 11
  • 458
  • 0
báo cáo khoa học: " Functional genomics and rheumatoid arthritis: where have we been and where should we go?" pdf

báo cáo khoa học: " Functional genomics and rheumatoid arthritis: where have we been and where should we go?" pdf

Ngày tải lên : 11/08/2014, 12:20
... rheumatoid arthritis Arthritis Res Ther 2006, 8:R105 16 Tanino M, Matoba R, Nakamura S, Kameda H, Amano K, Okayama T, Nasawa H, Suzuki K, Matsubara K, Takeuchi T: Prediction of efficacy of anti-TNF ... RA has largely used relatively straight­ orward computational biology approaches to f analyze the data Published studies have used hierarchical cluster analysis to classify patients (for example, ... that are believed to be the basis of this disease [19] There have already been some surprises, and these surprises in themselves demonstrate the value of ‘discovery science’ uninformed by a specific...
  • 5
  • 282
  • 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Ngày tải lên : 14/02/2014, 19:20
... immunocytochemistry and lgÆmL)1 for coimmunoprecipitation Materials and methods Animals Primary cultures, transfection and imaging of hippocampal and cerebellar neurons Hippocampal and cerebellar dissociated ... MAP2 CD2 domain (702–744 aa) in human, mouse and Gallus This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this ... MAP 2a ⁄ b (catalog number: AP20; Sigma-Aldrich, St Louis, MO, USA), MAP2 (catalog number: M1406; Sigma-Aldrich), EGFP (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA,...
  • 11
  • 658
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

Ngày tải lên : 14/02/2014, 22:20
... Academia Sinica and National Synchrotron Radiation Research Center (Taiwan, ROC) We thank Ms M.Sakai (Osaka University) for performing ultracentrifugation analysis and Mr K Mieda and M Sakata ... T, Matsumura H, Inoue T, Kai Y, Uegaki K, Hagihara Y, Ataka M & Ishikawa K (2005) Crystallization and preliminary X-ray diffraction analysis of thioredoxin peroxidase from the aerobic hyperthermophilic ... mutagene˚ sis at a site 11 A away from the reaction center, as reported for the P gingivalis SOD [7] This supports the hypothesis that cambialism is a consequence of multiple factors rather than...
  • 12
  • 762
  • 0
Tài liệu Inequalities in Higher Education and the Structure of the Labour Market pdf

Tài liệu Inequalities in Higher Education and the Structure of the Labour Market pdf

Ngày tải lên : 15/02/2014, 17:20
... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...
  • 19
  • 575
  • 0
Tài liệu The financial cycle and macroeconomics: What have we learnt? pdf

Tài liệu The financial cycle and macroeconomics: What have we learnt? pdf

Ngày tải lên : 17/02/2014, 21:20
... turning-point approach, as refined by Harding and Pagan (2006) As the orange (peaks) and green (troughs) bars indicate, the length is similar to that estimated through statistical filters, and the peaks and ... the Federal Reserve Bank of Dallas, Dallas, Texas, 24 May 30 Nakaso, H (2001): The financial crisis in Japan during the 1990s: how the Bank of Japan responded and the lessons learnt”, BIS Papers, ... that the real cause of the financial crisis was not “excess saving” but the “excess elasticity” of the international monetary and financial system: the monetary and financial regimes in place...
  • 38
  • 660
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Ngày tải lên : 19/02/2014, 05:20
... Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme and ... oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture were analogous, ... almost vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme The 637 nm band disappeared gradually and was replaced by a new broad...
  • 16
  • 617
  • 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

Ngày tải lên : 19/02/2014, 07:20
... [38] These sites all contain the sequence GAAA, and cleavage occurs between G and A The cleavage efciency, however, varied between sites, and correlated with the predicted secondary structure Also, ... 4ị The [pre-RNAnMg2+]active term is the concentration of active ribozyme, and [pre-RNA]total is the RNA concentration KMg2+ and KMn2+ are the apparent dissociation constants for the RNAnMg2+ and ... nucleotides, GAAATTTTAAAGCCGAATAAAACTTG) ends nucleotides before the 3Â-end of the intron The temperature program was 30 cycles of 94 C, 65 C, and 72 C (1 each) Transcription of PCR23S.5DGb and purication...
  • 14
  • 480
  • 0
Tài liệu Báo cáo khoa học: Proton transfer in the oxidative half-reaction of pentaerythritol tetranitrate reductase Structure of the reduced enzyme-progesterone complex and the roles of residues Tyr186, His181 and His184 pdf

Tài liệu Báo cáo khoa học: Proton transfer in the oxidative half-reaction of pentaerythritol tetranitrate reductase Structure of the reduced enzyme-progesterone complex and the roles of residues Tyr186, His181 and His184 pdf

Ngày tải lên : 20/02/2014, 02:21
... 5¢-CAGGTAACCGTGCGCG ACGCAAGCTCAACCAGGTCGAAG-3¢ (H18 1A, reverse primer), 5¢-GTTGAGCTTCACTCTGCGGCGGGTTACC TGCTGCATCAG-3¢ (H184, forward primer) and 5¢-CTG ATGCAGCAGGTAACCCGCCGCAGAGTGAAGCTCA AC-3¢ ... ligand and substrate binding For those members that contain a His-His pair, there has been no report of a systematic analysis of the contribution of each histidine residue to binding and catalysis ... catalysis Thus, to ascertain the role of each histidine residue, and to identify any differential contribution to binding and catalysis, we isolated the two mutant enzymes H18 1A and H18 4A Both the...
  • 12
  • 603
  • 0
Tài liệu Báo cáo khoa học: "Unsupervised Discourse Segmentation of Documents with Inherently Parallel Structure" pdf

Tài liệu Báo cáo khoa học: "Unsupervised Discourse Segmentation of Documents with Inherently Parallel Structure" pdf

Ngày tải lên : 20/02/2014, 04:20
... 1994; Utiyama and Isahara, 2001; Galley et al., 2003; Malioutov and Barzilay, 2006) Our work extends the Bayesian segmentation model (Eisenstein and Barzilay, 2008) for isolated texts, to the problem ... (i.e admissible changes from (z, t) to (z , t )), and the proposal distribution Q over these moves If the actual number of segments is known and only a linear discourse structure is acceptable, then ... The story begins by Magdalena saying that she has a day job A day job is your regular job that you work at from nine in the morning 'til five in the afternoon, for example She also has a small...
  • 5
  • 376
  • 0
Tài liệu Báo cáo Y học: Structure of the O-polysaccharide and classification of Proteus mirabilis strain G1 in Proteus serogroup O3 potx

Tài liệu Báo cáo Y học: Structure of the O-polysaccharide and classification of Proteus mirabilis strain G1 in Proteus serogroup O3 potx

Ngày tải lên : 21/02/2014, 15:20
... (Table 1) The TOCSY spectrum showed correlations between H1 and H2–H5 for GlcA and GalA and between H1 and H2–H4 for both GalNAc residues (GalNAcI and GalNAcII) The signals for H5 and H6 of GalNAcI ... analysis of the polysaccharide after acid hydrolysis revealed glucuronic acid (GlcA) and galacturonic acid (GalA) in the ratio  : Analysis on an amino-acid analyser showed the presence of 2-amino-2-deoxygalactose ... GlcA has the D configuration On the basis of the data obtained, it was concluded that the O-polysaccharide P mirabilis G1 has the structure shown in Fig This structure is similar to that of the...
  • 7
  • 465
  • 0
SAVINGS INSTITUTIONS AND BANKS THAT HAVE HAD THEIR NAME CHANGED OR HAVE BEEN ACQUIRED, MERGED OR CLOSED pptx

SAVINGS INSTITUTIONS AND BANKS THAT HAVE HAD THEIR NAME CHANGED OR HAVE BEEN ACQUIRED, MERGED OR CLOSED pptx

Ngày tải lên : 06/03/2014, 10:20
... Newark La Salle S&L Assn., Camden Lafayette American Bank, Bridgeport, CT Lakeland S&L Assn., Succasunna Lakeland Savings Bank, SLA, Succasunna Lakeland Savings Bank, Succasunna Lakeland State Bank, ... Head S&L Assn., Bay Head Bay State Bank, Ship Bottom Bayonne Community Bank, Bayonne Beach Haven National Bank and Trust Company, Beach Haven Bear Stearns Bank & Trust Company, Princeton Bear ... OR HAVE BEEN ACQUIRED, MERGED OR CLOSED Mainstay Federal Savings, FSB, Red Bank Manasquan S&L Assn., Manasquan Manasquan Savings Bank, SLA, Manasquan Manchester Trust Bank, Lakehurst Mantua B&L...
  • 23
  • 478
  • 0
Báo cáo khoa học: Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge potx

Báo cáo khoa học: Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge potx

Ngày tải lên : 06/03/2014, 22:21
... [10–12] Class aaRSs are characterized by the amino acid sequence motifs HIGH and KMSKS, and by having a catalytic domain with a classical Rossmannfold topology [13–16] Class aaRSs have their activesite ... helices a2 and a8 in the catalytic domain are colored cyan The linking p-helix a1 3 between the KMSKS domain and the anticodon domain is purple The two ligands (methionine and adenosine) bound to the ... helix a7 with strand b9 (Fig 1) The active site is positioned at the C-terminal edge of the sheet formed by the five parallel b-strands and the N-terminal ends of the helices a1 , a7 and a9 The methionine-binding...
  • 16
  • 514
  • 0
LONG TERM CHANGES IN VOTING POWER AND CONTROL STRUCTURE FOLLOWING THE UNIFICATION OF DUAL CLASS SHARES pdf

LONG TERM CHANGES IN VOTING POWER AND CONTROL STRUCTURE FOLLOWING THE UNIFICATION OF DUAL CLASS SHARES pdf

Ngày tải lên : 07/03/2014, 01:20
... Sferra, Lisa Guarrera, Sohbet Karbuz, Manfred Hafner, Anil Markandya and Ståle Navrud: The External Cost of European Crude Oil Imports Valentina Bosetti, Carlo Carraro, Romain Duval, Alessandra ... Ding and Anil Markandya: The Economic Valuation of Marine Ecosystems Andreas Madestam: Informal Finance: A Theory of Moneylenders Efthymia Kyriakopoulou and Anastasios Xepapadeas: Environmental ... in a Speculative Market: The Chinese Split-Share Reform Angelo Antoci, Fabio Sabatini and Mauro Sodini: The Fragility of Social Capital Alexander Golub, Sabine Fuss, Jana Szolgayova and Michael...
  • 46
  • 354
  • 0
Báo cáo khoa học: Structure of the atrial natriuretic peptide receptor extracellular domain in the unbound and hormone-bound states by single-particle electron microscopy ppt

Báo cáo khoa học: Structure of the atrial natriuretic peptide receptor extracellular domain in the unbound and hormone-bound states by single-particle electron microscopy ppt

Ngày tải lên : 07/03/2014, 03:20
... centered and grouped into self-similar groups by iterative multivariate statistical analysis-based classification Class averages were then generated by iterative alignment and averaging Among the 35 ... paper, and the sample was allowed to air dry Data were collected on a Tecnai F20 (FEI Company) located in the Microscopy and Imaging Facility at the University of Calgary (Calgary, Canada) The microscope ... and a GCase catalytic domain [8] ANP binding to the ECD stimulates the intracellular GCase domain, thereby generating the intracellular second messenger cGMP The mechanism of this transmembrane...
  • 9
  • 450
  • 0