e coli agar a hicrome
Phân lập, xác định đặc tính sinh học của e coli,salmonella gây tiêu chảy cho lợn sau cai sữa nuôi tại tỉnh lào cai và biện pháp phòng trừ
Ngày tải lên :
28/11/2013, 11:07
... Acid DPF Delayed Permeability Factor E coli Escherichia coli EMB Eosin Methylen-Bleu EPEC Enteropathogenic E coli ETEC Enterotoxigenic Escherichia coli F Fimbriae LPS Lipopolysaccharid LT Heat-labile ... Salmonella Shigella ST Heat-stable toxin TAE Tris - Acetic - EDTA TGE Transmissible Gastro Enteritis (B nh viờm d dy ru t truy n nhi m) VTEC Verotoxigenic Escherichia coli VT 2e Verotoxin 2e Tr ... Heat-labile toxin M Mucous NCCLS National Committee for Clinical Laboratory Standards OMP Outer membrane protein PCR Polymerase Chain Reaction R Rough RPF Rapid Permeability Factor S Smooth SS Salmonella...
- 87
- 1.1K
- 0
Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc
Ngày tải lên :
23/03/2014, 13:20
... maintained at 0.30 M in all assays by the addition of KCl All kinetic parameters were determined in triplicate and average values are reported The reported errors are standard deviations Initial rate ... in the NH3 tunnel of E coli CTPS Experimental procedures General materials and methods All chemicals were purchased from Sigma-Aldrich Canada Ltd (Oakville, ON, Canada), except where mentioned ... the ability of E coli CTPS to utilize alternative substrates We show that replacement of Leu109 by alanine in E coli CTPS causes the enzyme to discriminate between nascent NH3 and the bulkier analogue...
- 9
- 404
- 0
Báo cáo khoa học: " Low numbers of intestinal Shiga toxin-producing E. coli correlate with a poor prognosis in sheep infected with bovine leukemia virus" pps
Ngày tải lên :
07/08/2014, 23:22
... the impact of BLV infection and STEC carriage on B-cell percentages, especially in STEC-treated sheep Moreover, B-cell expansion by STEC treatment increased the availability of BLV cellular targets, ... gain, among BLV-infected sheep 2) Repeated oral treatments with STEC were associated with increased percentages of B cells in peripheral blood, although treatment did not consistently increase the ... numbers of fecal STEC 3) STEC score provided a means of expressing time-averaged STEC colonization in sheep and was used effectively in statistical analysis 4) The correlation between STEC score...
- 5
- 248
- 0
Thiết kế vector biểu hiện con đường sinh tổng hợp provitamin a trong e coli
Ngày tải lên :
31/10/2016, 16:34
... DNA : Deoxyribonucleic Acid E coli : Escherichia coli EDTA : Etilendiamin tetraaxetic acid IPTG : Isopropyl Thiogalactoside Kb : Kilo base – Kilo bazơ nitơ LB : Laria Broth TAE : Tris-acetate-EDTA ... Monica A Schmidt1, Wayne A Parrott , David F Hildebrand , R Howard Berg , Amanda Cooksey, Ken Pendarvis , Yonghua He , Fiona McCarthy and Eliot M Herman (2014) "Transgenic soya bean seeds accumulating ... Misawa, M N., Kazuo Kobayashi, Shigeyuki Yamano, Yuko Izawa, Katsumi Nakamura, and Keij Harashima (1990) "Elucidation of Pathway the Erwinia uredovora Carotenoid Biosynthetic by Functional Analysis...
- 51
- 936
- 0
Hoàn thiện quy trình biến nạp đoạn dna vào tế bào vi khuẩn E. coli DH5
Ngày tải lên :
27/10/2012, 10:53
... Polymerase Chain Reaction RE Restriction Enzyme RNA Ribonucleic acid RFLP Restriction fragment length polymorphism SDS Sodium dodecyl sulfate TAE Tris Acetate EDTA Taq Thermus aquaticus Kb kilobase ... Unit DNA Deoxyribonucleic acid dNTP 3’- Deoxyribonucleoside- 5’- triphosphate ETDA Ethylenediamine tetraacetic acid IPTG Isopropyl-β-D-thiogalactoside MCS Multiple cloning Site OD Optical Density ... kilobase dATP deoxyadenosine triphosphate dGTP deoxyguanosine triphosphate dCTP deoxycytidine triphosphate dTTP deoxythymidine triphosphate Tris- HCL (hydroxymethyl) aminomethane hydrochloride UV...
- 23
- 1.3K
- 15
Thử nghiệm sản xuất kháng huyết thanh kháng vi khuẩn E. coli
Ngày tải lên :
29/10/2012, 14:14
... số loại tá chất: Freund’s Complete Adjuvant (FCA) Freund’s Incomplete Adjuvant (FIA), Aluminum hydroxide (ALUM), Rabi Adjuvant System (RAS), Syntex Adjuvant Formulation (SAF)… 2.1.5 Cơ chế đáp ... lặp lại nhƣ lipopolysaccharide Escherichia coli, flagellin Salmonella, vỏ polysaccharide vi khuẩn Pneumococcus, dextrans, levans polyglutamic acid Bởi chúng trình tự polimer lặp lại nên phân tử ... glucose, lactose, manitol, sorbitol, phản ứng -galactosidase dƣơng tính Indol dƣơng tính, methyl red dƣơng tính, Voges-Proskauer âm tính, citrate âm tính Không sử dụng phenylalanin, ure, gelatin,...
- 64
- 913
- 3
Các phương pháp phát hiện E.Coli trong thực phẩm
Ngày tải lên :
30/10/2012, 10:39
... (Enterotoxigenic E. coli) : E. coli sinh độc tố ruột EIEC (Enteroinvasive E. coli) : E. coli xâm nhập ruột EAEC (Enteroaggregative E. coli) : E. coli ngưng tập ruột DAEC (Diffusely adherent E. coli) : E. coli ... ACAGCGTGGTTGGATCAACCT EhxA-F GTTTATTCTGGGGCAGGCTC EhxA-R CTTCACGTCACCATACATAT Stx1-F CAGTTAATGTGGTGGCGAAGG Stx1-R CACCAGACAATGTAACCGCTG Stx2-F ATCCTATTCCCGGGAGTTTACG Stx2-R GCGTCATCGTATACACAGGAGC Uid-F ... decarboxylase Arginine dihydrolase Ornithine decarboxylase Di động D-Glucose acid E. coli (bình thường) + + + E. coli (inactive ) T T + - E. blatta e E.fergus onii E. herma nnii E. vulneri s E. alberti...
- 53
- 7.7K
- 123
Xây dựng quy trình biến nạp đoạn DNA vào tế bào vi khuẩn E.coli DH5α
Ngày tải lên :
31/10/2012, 09:35
... động operon Lac (lactose operon) Operon Lac đoạn DNA ch a: Ba gen cấu trúc lacZ (mã hoá β- galactosidase), lacY (mã hoá permerase) lacA (mã hoá acetylase) Một trình tự nucleotide gọi promoter (vùng ... sinh (bacto tryptone, bacto yeast extract, natri chlorua, ampicillyn) Môi trƣờng LB agar (bacto tryptone, bacto yeast extract, natri chlorua, agar ) 24 Môi trƣờng LB agar, kháng sinh ampicillyn, ... 5’ – ATTAACCCTCACTAAAGGGA – 3’ (D a theo Samuel S.M.Sun, 1994 Method in plant molecular biology and Agricultural biotechnology, A laboratory Training manual, ROC Taiwan) Primer ITS4 primer ITS5...
- 74
- 3.3K
- 15
Nghiên cứu tìm kiếm vaccine hiệu quả cho việc phòng tiêu chảy trên heo sau cai sữa do E. coli (81 trang)
Ngày tải lên :
03/11/2012, 09:10
... toàn cầu Escherichia coli 4 Phân loại Giới: Bacteria Ngành: Proteobacteria Lớp: Gamma Protebacteria Bộ: Enterobacteriales Họ: Chi: Escherichia Enterobacteriaceae Loài: Escherichia coli 2.1.2 ... days aged), adjuvant injection two times with 10 days interval The efficacy of auto-vaccine was evaluated by antiody titers, medium daily gain and the side effects Result: The auto-vaccine made ... produce the autovaccine Third, set up the experiment to evaluate the efficiency of auto-vaccine (the experiment was repeated in times): The first group: litters (28 piglets, from 14 to 20 days aged),...
- 81
- 811
- 5
Khảo sát tình hình nhiễm E.coli và Coliforms trong nước uống
Ngày tải lên :
06/11/2012, 09:47
... - EAEC (Enteroaggregative E coli) , E coli kết tập ruột - EHEC (Enterohemorrhagic E coli) , E coli gây xuất huyết ruột - EPEC (Enteropathogenic E coli) , E coli gây bệnh đƣờng ruột - ETEC (Enterotoxigenic ... Blue E coli: Escherichia coli LT: Heat Labile ST: Heat stable MR-VP: Methyl Red- Voges Proskauer MPN: Most Probable Number 10 MCK: MacConKey 11 KIA: Kligler Iron agar 12 IMViC: Indol, Methyl red, ... -* denotes a statistically significant difference 38 Bảng 7B Bảng MPN Table For tubes each at 0.1, 0.01, and 0.001 g inocula, the MPNs per gram and 95 percent confidence intervals Pos tubes MPN/g...
- 48
- 1.3K
- 21
Xác định vai trò gây bệnh của vi khuẩn E.coli , C.perfringens trong hội chứng tiêu chảy ở lợn từ sơ sinh đến 60 ngày
Ngày tải lên :
06/11/2012, 11:22
... : Adherence Enteropathogenic Escherichia coli Brain-heart infusion Cng s Colonial Forming Unit Edema disease Edema disease pathogenic Enterohaemorrhagic Escherichia coli Eosin Methylene Blue Agar ... Gram dng Lờn men ng TSI C perfringens Enterobacteriaceae R/Y/H2 S+ Lờn men ng Lactose + Lờn men ng Lactose - E coli Salmonella K pneumoniae Enterobacter aerogenes Edwardsiella Proteus Salmonella ... Agar Enteropathogenic Escherichia coli Enterotoxigenic Escherichia coli Heamolysin Heamolysin Khỏng nguyờn Heat-Labile enterotoxin Nh xut bn Polymerase Chain Reaction Shiga-like toxin Shiga-like...
- 116
- 1.8K
- 8
Nghiên cứu một số đặc điểm dịch tễ yếu tố gây bệnh của vi khuẩn e. Coli trong hội chứng tiêu chảy ở bê nghé tại sơn la và thử nghiệm phác đồ điều trị
Ngày tải lên :
12/11/2012, 11:59
... Colicin V C perfrigens : Clostridium perfringens E coli : Escherichia coli EMB : Eosin Methylene Blue Agar EPEC : Enteropathogenic E coli ETEC : Eneterotoxigenic E coli ETEE : Enterotoxinic E ... http://www.lrc-tnu.edu.vn 13 DANH MỤC CÁC CHỮ VIẾT TẮT ADN : Acid Deboxy nucleic AEEC : Adhereneia Enteropathogenic E coli AMP : Adenosine Monophosphate ATP : Adenosin Triphosphate BHI : Brai-heart infusion ... E coli F : Fimbriae GTP : Guanosin 5-Triphosphate Hly : Heamolyzin LT : Heat-Labile-Toxin LTa : Heat-Labile-Toxin a LTb : Heat-Labile-Toxin b NTEC : Nectrotoxigenic E coli PCR : Polymerase Chain...
- 110
- 2.7K
- 12
Nghiên cứu, xác định một số đặc điểm dịch tễ của hội chứng tiêu chảy và sự nhiễm khuẩn E.coli ở trâu nuôi tại Bảo Yên - Lào Cai và biện pháp phòng trị bệnh
Ngày tải lên :
12/11/2012, 14:43
... Enterropathogenic Escherichia coli : Brain-heart infusion : Colinial Forming Unit : Edema disease : Edema disease pathogenic : Entero heamorrhagic : Eosin Methylene Blue Agar : Enteropathogenic Escherichia coli ... vào yếu tố gây bệnh để chia chúng vào nhóm:Enterotoxigenic(ETEC),Enteropathogenic(EPEC),Enteroinvasive(EIEC) ,Enterohemorrhagic(EHEC) Attaching and Effacing E. coli( AEEC) 1.2.6.1 Các yếu tố độc ... Shiga-like toxin : Samonella Shigella : Heat-Stabe Enterotoxin (a, b) : Heat-Stabe : Shiga-toxin 2e : Triple Sugar Iron : Ultraviolet : Vi khuẩn : Voges Pros Kaver : Veterotoxin 2e : Verotoxigenic...
- 98
- 1.2K
- 1
NGHIÊN CỨU CHẾ TẠO KHÁNG THỂ QUA LÒNG ĐỎ TRỨNG GÀ ĐỂ PHÒNG CHỐNG TIÊU CHẢY VÀ SƯNG PHÙ ĐẦU DO E. coli Ở LỢN
Ngày tải lên :
15/11/2012, 09:48
... Enterotoxigenic Escherichia coli (ETEC), Enteropathogenic Escherichia coli (EPEC), Verotoxigenic Escherichia coli (VTEC) Adherencia Enteropathogenic Escherichia coli (AEEC) E coli gây bệnh tiêu ... 135 *Sor: Sorbitol Ara: Arabinose Gal: Galactose Mal: Maltose Sal: Salicin Lac: Lactose Mat: Mannit Glu: Glucose Fru: Fructose Raf: Raffinose Sac: Saccharose Man: Mannose Gas: Phản ứng sinh (+): ... khoa học giới đặc biệt quan tâm 1.2 Vi khuẩn Escherichia coli Trực khuẩn ruột già Escherichia coli thuộc họ Enterobacteriaceae Trong vi khuẩn đờng ruột, E coli loài phổ biến E coli có tên Bacterium...
- 69
- 1.5K
- 7
Khảo sát khả năng sinh axit lactic và tính kháng của Lactobacillus acidophilus đối với vi khuẩn E.coli dùng để sản xuất chế phẩm Probiotic
Ngày tải lên :
17/11/2012, 09:42
... TẮT MRSA: De Man, Rogaso, Sharpe, Agar MRSB: De Man, Rogaso, Sharpe, Broth TSB : Trypticase Soy Agar EC : Enrichement E coli Broth EMB : Eosin Methylene Blue Agar - vii DANH SÁCH CÁC BẢNG Trang ... W.I.Li, Benjamin G.Brackett and Jaroslava Halper Culture Supernatant of Lactobacillus acidophilus Stimulates Proliferation of Embryonic Cell 12 Lievin-Le Moal, V., R Amsellem, A L Servin, and M.-H ... Coconnier 2002 Lactobacillus acidophilus (strain LB) from the resident adult gastrointestinal microflora exerts activity against brush border damage promoted by a diarrhoeagenic Escherichia coli...
- 60
- 1.5K
- 5
Phân lập vi khuẩn Bacillus subtilis trong phân heo và thử đối kháng với e.coli gây bệnh tiêu chảy trên heo
Ngày tải lên :
17/11/2012, 09:45
... Michael A Scott, Stephen D Kachman, and Rodney A Moxley,2004 Relative Importance of Heat-Labile Enterotoxin in the Causation of Severe Diarrheal Disease in the Gnotobiotic Piglet Model by a Strain ... transferase, and a fatty acid synthase Proc Natl Acad Sci U S A, 9; 96(23): 13294–13299 The National Academy of Sciences 20 Valérie Leclère, Max Béchet, Akram Adam, Jean-Sébastien Guez, Bernard ... E coli với tế bào thành ruột chia chủng E coli gây bệnh thành loại: enterotoxigenic E coli (ETEC), enterohemorrhagic E coli (EHEC), enteroaggregative E coli (EAEC), enteropathogenic E coli (EPEC),...
- 56
- 1.4K
- 5
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2