dysphagia severe weight loss and stricture

Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Ngày tải lên : 09/08/2014, 10:20
... cultured FLS cells and co-cultures of DRG neurones and FLS cells (from normal and acutely or chronically inflamed joints) were analysed for the production of prostaglandin E2 (PGE2) and IL-6 The samples ... cultured and handled in the same way as the co-cultures After culturing for 24 hours, all cells on the glass cover slips were fixed and used for immunocytochemical labelling of the NK1, the BK (B2) and ... IR and, therefore, the antibody against NSE is a good tool to differentiate between neurones and FLS cells The neurones had round perikarya of varying sizes and thin neurites spanning over and...
  • 12
  • 184
  • 0
Báo cáo hóa học: " Investigating the Influence of PFC Transection and Nicotine on Dynamics of AMPA and NMDA Receptors of VTA Dopaminergic Neurons" doc

Báo cáo hóa học: " Investigating the Influence of PFC Transection and Nicotine on Dynamics of AMPA and NMDA Receptors of VTA Dopaminergic Neurons" doc

Ngày tải lên : 19/06/2014, 08:20
... injection even within one hour, and AMPA/NMDA area ratio and the KL divergence analysis method are able to provide a more complete understanding of AMPA and NMDA responses, and may be better fit for ... AMPA and NMDA curves represent the whole GluR response with respect to time Therefore, we estimated the AMPA/NMDA area ratio and KL divergence to better understand the dynamics of AMPA and NMDA ... calculated the KL divergence for each pair of AMPA and NMDA signals, under different experimental conditions (nicotine and saline and also with PFC intact and transected rats) Subsequently, the statistical...
  • 28
  • 431
  • 0
Báo cáo hóa học: " Expression of HIV receptors, alternate receptors and co-receptors on tonsillar epithelium: implications for HIV binding and primary oral infection" doc

Báo cáo hóa học: " Expression of HIV receptors, alternate receptors and co-receptors on tonsillar epithelium: implications for HIV binding and primary oral infection" doc

Ngày tải lên : 20/06/2014, 01:20
... damage and repair in ex vivo tonsil organ culture and HIV infection of tonsil cells Epithelial damage and repair in ex vivo tonsil organ culture and HIV infection of tonsil cells Small randomly ... HIV virions and exposed mucosal surfaces and that both the properties of the inoculum (cell free HIV virions and/ or cell associated infectivity in the form of HIV-infected cells) and the characteristics ... surface macromolecules and migrating cells implicated in HIV binding and uptake Schematic representation of cell surface macromolecules and migrating cells implicated in HIV binding and uptake The inset...
  • 13
  • 308
  • 0
Báo cáo khoa hoc:" Expression of estrogen and progesterone receptors in vestibular schwannomas and their clinical significance" docx

Báo cáo khoa hoc:" Expression of estrogen and progesterone receptors in vestibular schwannomas and their clinical significance" docx

Ngày tải lên : 11/08/2014, 07:21
... obtained and the standard streptavidin biotin peroxidase immunohistochemical method was used for the expression of estrogen and progesterone receptors Estrogen receptor (Clone 1D5, Dako, USA) and ... authors ranging from ligand binding studies and immunohistochemical methods to molecular techniques like polymerase chain reaction and Northern blot analysis Positivity of estrogen and progesterone ... is the most common cerebellopontine angle tumor and represents 9% of all brain tumors (Figure 1) Expression of estrogen and progesterone receptors and their potential role in the progression of...
  • 5
  • 252
  • 0
Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx

Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx

Ngày tải lên : 12/08/2014, 04:21
... parental cell line and the derived clone K4 which expresses hCD4 and hCXCR4 infected with MN isolate; (B), CCRT parental cell line and the C4, C5, and C6 derived clones expressing hCD4 and hCCR5 infected ... cotton rat cell lines VCRT (C17) and CCRT (C4, C5, and C6) expressing hCD4 and hCCR5 molecules were established using a pleiotropic retrovirus expression system and analyzed by flow cytometry Measurable ... cells CB provided with reagents, and with VP, and GP participated in the design of the study, analysis of the data, and preparation of the manuscript All authors read and approved the final manuscript...
  • 9
  • 329
  • 0
Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf

Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf

Ngày tải lên : 12/08/2014, 04:21
... parental cell line and the derived clone K4 which expresses hCD4 and hCXCR4 infected with MN isolate; (B), CCRT parental cell line and the C4, C5, and C6 derived clones expressing hCD4 and hCCR5 infected ... cotton rat cell lines VCRT (C17) and CCRT (C4, C5, and C6) expressing hCD4 and hCCR5 molecules were established using a pleiotropic retrovirus expression system and analyzed by flow cytometry Measurable ... cells CB provided with reagents, and with VP, and GP participated in the design of the study, analysis of the data, and preparation of the manuscript All authors read and approved the final manuscript...
  • 9
  • 251
  • 0
Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

Ngày tải lên : 13/08/2014, 03:20
... scoring and supervised pathological studies TKW and SK provided assistance in physiological studies and data interpretation ML conceived the study, and participated in its design and coordination and ... MM designed the study and carried out most of the animal studies, assessment of lung injury and VEGF related molecules in the lung, and drafted the manuscript BH designed and conducted the in ... immunostaining and confocal microscopy may provide more convincing evidence When using western blotting and real-time quantitative RTPCR to measure the protein and mRNA levels of VEGF and its receptors,...
  • 13
  • 290
  • 0
Serotonin and serotonin receptors in neural stem and progenitor cell proliferation

Serotonin and serotonin receptors in neural stem and progenitor cell proliferation

Ngày tải lên : 11/09/2015, 10:15
... Siam, Ms Raquel Magalhães and Mr Lee Kong Heng for their help and insights for the collaborative work on cryopreservation; and also to Assoc Prof Manoor Prakash Hande and Dr Anuradha Poonepalli ... Julian, Jiamei and Shera who help me in one way or another and in spending time with project discussions; and to all other lab members whose presence make the lab environment a pleasant one And last ... and neurogenesis 5 6 12 15 16 1.2.4 1.2.5 The serotonergic system and neurogenesis Role of 5-HT in brain development 5-HT biosynthesis and breakdown The 5-HT receptors subtypes – properties and...
  • 226
  • 228
  • 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Ngày tải lên : 07/03/2014, 16:20
... activation and interaction with receptor kinases 130 A Faussner et al Results Construction of truncated and point mutated B2wts and B1 ⁄ B2 receptor chimeras Several studies with truncations of, and ... motifs in the region between the palmitoylated C324 and N338 Candidates would include G328-C329 and ⁄ or the negatively charged residues E332 and E337, as they are highly conserved in B2wt among ... receptor kinases and in receptor specific G protein activation Materials and methods Materials Flp-In T-REx (HEK 293) cells were purchased from Invitrogen (Groningen, the Netherlands) and [2,3-prolyl-3,4–...
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Ngày tải lên : 14/02/2014, 14:20
... Dissociation time courses and effects of unlabeled ligands and low pH on the dissociation rates of [125I]TC-PCSK9 (A) and [125I]TC-PCSK9-D374Y (B) from HepG2 cells Binding to equilibrium and removal of ... values obtained for the higher-affinity and lower-affinity binding sites are listed in Table The high-affinity and the low-affinity sites accounted for 25% and 75% of the total binding, respectively ... curve), D374Y (lower curve) and S127R (middle curve) variants of PCSK9 Bars the denote range of duplicate determinations For wild-type PCSK9 and PCSK9-S127R, only the upper and lower, respectively,...
  • 13
  • 712
  • 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Ngày tải lên : 18/02/2014, 13:20
... included a DNase I treatment, and cDNA synthesized as described above The time points analyzed were 1–2 and 4–5 days pre-vitellogenesis, and 6, 12, 24, 36, 48 and 72 h PBM To standardize qPCR inputs, ... was extracted from the fat body and ovaries of pre-vitellogenic females 5–6 days after eclosion and from vitellogenic females 6–12 and 18–24 h after a blood meal, and then was subjected to 1236 ... An gambiae and Ap mellifera NRs, and one which is a likely ortholog of the Ap mellifera and T castaneum PNR-like NR [20–22] that is also present in the genome of An gambiae (Table S1 and Fig 1)...
  • 22
  • 578
  • 0
Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx

Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx

Ngày tải lên : 19/02/2014, 07:20
... ligand affinity between Y7 and Y2 may prove very useful for studies of ligand–receptor interactions and 3D modeling, and we have previously been able to utilize differences between chicken and ... radioligand This radioligand had iodinated tyrosines at positions 21 and 27 and a specific activity of 4000 CiÆmmol)1 Saturation experiments were carried out with serial dilutions of radioligand, and ... Q8QGM3 The affinities of peptides and nonpeptidergic ligands for chicken Y7 were established through competition experiments with radioligand 125I-pPYY (Table and Fig 8) The most potent inhibitor...
  • 16
  • 580
  • 0
Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-affinity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt

Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-affinity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt

Ngày tải lên : 19/02/2014, 12:20
... Fig Comparison of amino acid sequences of SH2 domains from Src and the mouse Grb4, and expression and purification of the Grb4 SH2 and RGS3 PDZ domains (A) Secondary structural elements are from ... YEKV-pY304 (d), YEKIpY304 (j), YEKI-pY304 (m) and YEEI-pY304 (r) (Fig 3) EphrinB2(301–333) series WT pY304 pY311 and pY316 pY311 or pY316 pY304 and pY311 pY304 and pY316 pY330 or pY331 EphrinB2(301–309) ... example, pYEEI, pYDNV, pYTDM and pYTDL for Src family SH2 domains; pYENP, pYTEV and pYMDL for the Abl SH2 domain; pYDHP, pYKFL and pYNR for the CrK SH2 domain; pYDEP, pYDED and pYDEV for the Nck SH2...
  • 12
  • 551
  • 0
Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved fluorescence resonance energy transfer pdf

Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved fluorescence resonance energy transfer pdf

Ngày tải lên : 21/02/2014, 00:20
... Anti-gp120 Ig and anti-FLAG Ig identified bands corresponding to proteins with a molecular mass equivalent to  43 kDa and 85 kDa for D2L and  39 kDa and 80 kDa for D2S (Fig 1) No bands were detected ... expression of HIV- and FLAG-tagged D2L and D2S receptors in Sf9 cells To achieve this, mAbs directed against gp120 (clone 11/4C) and the FLAG sequence were used, and Fig shows the band pattern visualized ... the dopamine D2L and D2S receptors can form constitutive homo- and hetero-oligomers in two expression systems (Sf9 and HEK293 cells) and these are not regulated by receptor ligands Our study applied,...
  • 11
  • 618
  • 0
Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

Ngày tải lên : 21/02/2014, 03:20
... sieve and showed a broad electrophoretic band mainly in the range 70±110 kDa, which could be converted into the monomer and dimer bands after treatment with chondroitinase ABC (Fig 2, lanes and ... Kidney (A and B) and skeletal muscle (C and D) from 3-week-old Lamb2 +/+ and ±/± littermates were stained with anti-b2 serum In the control, basement membranes throughout the kidney and skeletal ... and GTCACTCGAGCTAAAGGCC CGTCTGGTGAATCAAG, respectively, and for b2 GTC AGCTAGCCCGTCCCTGTGACTGTGATG and GTC ACTCGAGCTAGGCTTGACAGCCTGCAGGG, respectively They were used for ampli®cation by PCR and...
  • 12
  • 509
  • 0
Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Ngày tải lên : 21/02/2014, 03:20
... the resolution of the X-ray and NMR structures of the Wntx called bucandin and WTX [16,27,28] When we started this work, 22 amino acid sequences of Wntxs were known and it was clear to us that ... Considering that the two toxins display 11 residue differences and that the competition systems used (human and rat on one hand, and chicken on the other) are not identical in the two studies, ... precipitates were washed three times and dried, dissolved in 10% acetic acid and lyophilized The synthetic toxin was reduced with molar excess of TCEP under acidic conditions and purified by RP-HPLC using...
  • 10
  • 395
  • 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Ngày tải lên : 07/03/2014, 15:20
... found at positions )4, )7, )12 and )15, and hydrophilic residues are found at positions )5, )6, )8, )9, )11, )13 and )14 Along with genes that encode bacteriocin and immunity proteins, which protect ... and varying the solvent from 0% to 70% trifluoroethanol in water were collected at 25 °C Data were collected every 0.05 nm and were the average of eight scans The bandwidth was set at 1.0 nm and ... during export and processing In summary, this work describes the chemical synthesis and properties of the 66-amino acid bacteriocin precursor preCbnB2, and the biochemical production and isotopic...
  • 9
  • 519
  • 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Ngày tải lên : 07/03/2014, 16:20
... SMEZ1 and 2), three have one Cys (SEI, SEK and SPEC), two have three Cys (SEG and SPEA) and only SSA has more than that, five Cys As discussed later, the fact that SSA has two Cys residues (Cys26 and ... hVb2.1hCb2 and hVb1hCb2 (genes kindly provided by U Utz and R P Sekaly, University of Montreal, Canada), were cloned between the NdeI and EcoRI restriction sites of the pET17b expression vector and ... NaCl/Pi and concentrated to mgÆmL)1 hVb2.1hCb2 and hVb1hCb2 were also produced as inclusion bodies and refolded at pH 8.5 Purification steps included gel filtration on a Superdex 200 FPLC column and...
  • 9
  • 485
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... two immunoreactive bands were observed at approximately 40 and 51 kDa (Fig 3A) The calculated molecular weight for the I7 OR is 39 kDa, it is therefore likely that the 40 kDa band corresponds to ... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40 ... conditions for the production of the I7 OR in yeast and used biochemical and immunological methods to estimate the levels of receptor expression and its cellular localization Results Yeast transformations...
  • 14
  • 473
  • 0