don apos t hold back on cool weapons or cool things to do

creating emotion in games  the craft and art of emotioneering

creating emotion in games the craft and art of emotioneering

Ngày tải lên : 04/06/2014, 12:01
... World That Takes A While to Figure Out Friendship or Responsibility Toward NPCs You Care About Revenge Don' t Hold Back on Cool Weapons or Cool Things to Do Don' t Change All the Rules at the End World ... photography all contribute to the entertainment This document was created by an unregistered ChmMagic, please go to http://www.bisenter.com to register it Thanks In this book, I'm attempting to ... This is the crucial distinction between interactive and linear entertainment Interactive works demand that the player has the ability to act; to affect the situation; to make a difference at every...
  • 618
  • 924
  • 0
Tài liệu Black and White in Photoshop CS3 and Photoshop Lightroom P2 docx

Tài liệu Black and White in Photoshop CS3 and Photoshop Lightroom P2 docx

Ngày tải lên : 19/01/2014, 22:20
... tells the printer how to translate and convert the colors from the monitor so that the image outputs correctly onto the paper This translation is specified according to the type of printer, paper, ... to experiment This setting anticipates the viewing conditions of a PC monitor (important for web graphics), and the darkening is roughly equivalent to a 25% dot gain setting The Dot Gain settings, ... happen If the print driver options are not set correctly, using the correct profile, it will be difficult to even come close to replicating the image you see on your monitor to the output print See...
  • 10
  • 398
  • 0
Tài liệu Black and White in Photoshop CS3 and Photoshop Lightroom P1 pptx

Tài liệu Black and White in Photoshop CS3 and Photoshop Lightroom P1 pptx

Ngày tải lên : 19/01/2014, 22:20
... is important that what 14 Color Management for Black and White we see on our monitor be relatively accurate if we ultimately want our prints to match what we see on the monitor If the monitor is ... Profiles are the digital equivalent to the translators that interpret the dialogue between ambassadors from one language to another Therefore, it is extremely important to know how to set this profile ... Problematic desktop 12 Color Management for Black and White Not the best or most effective way to evaluate color or neutrality Best practice!!! In order to control this phenomenon, it is best to set...
  • 40
  • 404
  • 1
focal press black and white in photoshop cs3 and photoshop lightroom aug 2007

focal press black and white in photoshop cs3 and photoshop lightroom aug 2007

Ngày tải lên : 24/04/2014, 08:53
... is important that what 14 Color Management for Black and White we see on our monitor be relatively accurate if we ultimately want our prints to match what we see on the monitor If the monitor is ... tells the printer how to translate and convert the colors from the monitor so that the image outputs correctly onto the paper This translation is specified according to the type of printer, paper, ... Profiles are the digital equivalent to the translators that interpret the dialogue between ambassadors from one language to another Therefore, it is extremely important to know how to set this profile...
  • 266
  • 396
  • 0
Creative black and white photograpghy

Creative black and white photograpghy

Ngày tải lên : 07/03/2016, 14:23
... editor The editor’s role is to clarify what the communicator does The editor must have an understanding of the subject at hand and a great affinity for the communication form A picture editor, ... print contrast Print contrast is probably better referred to as gradation or print grade It refers to the tonal change in the print, relative to the density change in the negative The higher the ... developing time is It’s not important which way you choose to test your negatives, just that it be consistent For my work, I find that traditional Zone System density values don t work as well...
  • 200
  • 518
  • 0
The JSP Files (Part 3) - Black Light and White Rabbits

The JSP Files (Part 3) - Black Light and White Rabbits

Ngày tải lên : 23/10/2013, 00:15
... be exploring the JSP Response object, used to process data from HTML forms so you don' t want to miss that one! Note: All examples in this article have been tested on Linux/i586 with Tomcat 3.2 ... back next time for more on this), the Response object is typically used to send information to the browser; this information could include HTTP headers, redirection URLs, cookies and a variety ... the String object's capabilities in the first part of this tutorial But as we progress further, you're going to need to know a little bit more to make full use of its power First, there's the...
  • 20
  • 410
  • 0
Black Box and White Box testing

Black Box and White Box testing

Ngày tải lên : 25/10/2013, 03:20
... habits Laboratory tests are mostly performed to assess the general usability of the system Due to the high laboratory equipment costs laboratory tests are mostly only performed at big software ... their orders as print-out, that neither source texts nor target texts are properly organised and stored and, last but not least, individual translators are not too motivated to change their working ... for system testing And testing the units inside the box becomes white box testing This is one way to think about coverage Another is to contrast testing that aims to cover all the requirements...
  • 9
  • 596
  • 1
Men Aren’t Stupid and Nine Other Free Lessons That Will Change Your Life pptx

Men Aren’t Stupid and Nine Other Free Lessons That Will Change Your Life pptx

Ngày tải lên : 28/06/2014, 00:20
... definitely don' t need to talk to him that frequently Talk to him 15 to 20 minutes at the most (I know, I know, this is a tough one, but trust me, it works.) If he wants more of your time than that he ... they’re given the opportunity They know that if we don t have regular contact with them, we’re liable to forget their name with a quickness So, they try to this “friend” thing to keep us on the ... why they don t direct their “advice” to men, but I think we know the answer to that question: Men don t buy relationship books Why? Because men are going to what they're going to They’re not interested...
  • 37
  • 336
  • 0
Các thuật toán cơ bản của Black and Red Tree

Các thuật toán cơ bản của Black and Red Tree

Ngày tải lên : 19/04/2013, 10:36
... ĐIỆN T TRỰC TUYẾN Cây Đỏ Đen Tháng năm 2005 return erase(z); } iterator next(iterator i) { if (i->right != NIL) { for (i = i->right; i->left != NIL; i = i->left); } else { iterator p = i->parent; ... nodeColor; typedef struct NodeTag { struct NodeTag *left; /* Con trái */ struct NodeTag *right; /* Con phải */ struct NodeTag *parent; /* Cha */ nodeColor color; /* Màu node (BLACK, RED) */ KeyType ... Hồng Phú THƯ VIỆN ĐIỆN T TRỰC TUYẾN Cây Đỏ Đen Tháng năm 2005 return i; } iterator end() { /* Trả trỏ đến giá trị cuối */ return NULL; } RecType value(iterator i) { return i->rec; } StatusEnum...
  • 31
  • 625
  • 0
Hull and White model

Hull and White model

Ngày tải lên : 18/10/2013, 03:20
... respect to t From the formula B t; T  = exp f,r t C t; T  , A t; T g ; we have i h  dB t; T  = B t; T  ,C t; T  dr t , C t; T  dr t dr t , r t Ct t; T  dt , At t; T  dt = B t; ... , t r t  , C 2 t; T  2 t , r t Ct t; T  , At t; T  = r t : We leave the verification of this equation to the homework After this verification, we have the formula dB t; T  = r t B t; T ... t; T  , C t; T   t , t r t  dt , C t; T  t dW t , C 2 t; T  2 t dt , r t Ct t; T  dt , At t; T  dt : Because we have used the risk-neutral pricing formula "  ZT   B t; T ...
  • 10
  • 250
  • 0
Tài liệu Bài 6: Principal Component Analysis and Whitening pdf

Tài liệu Bài 6: Principal Component Analysis and Whitening pdf

Ngày tải lên : 23/12/2013, 07:19
... of onto the set of orthogonal matrices [284] This is somewhat analogous to the normalization of one vector ; the vector =k k is the projection of onto the set of unit-norm vectors (the unit sphere) ... orthogonal or orthonormal, but the iterative algorithms not always automatically produce orthogonality Then it may be necessary to orthogonalize the vectors after each iteration step, or at some suitable ... which the weight vectors are gradually updated until they become orthonormal and tend to the theoretically correct eigenvectors The network also has the ability to track slowly varying statistics...
  • 20
  • 679
  • 1
Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx

Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx

Ngày tải lên : 14/02/2014, 14:20
... Some parents took the opportunity to indicate strong support for SHE in school Parent 1: It is extremely important that children learn correct information early If well-rounded information is provided, ... 1.3 Note: Response options: = not at all important, = somewhat important, = important, = very important, = extremely important N = 3,941 to 4,027 Table Grade Level at which Parents Thought Specific ... school, but they may disagree about how important it is to include some of the more “controversial” topics, such as masturbation or sexual orientation, or about the appropriate grade level for introducing...
  • 13
  • 473
  • 0
Tài liệu The Effect of TARP on Bank Risk-Taking Lamont Black and Lieu Hazelwood docx

Tài liệu The Effect of TARP on Bank Risk-Taking Lamont Black and Lieu Hazelwood docx

Ngày tải lên : 16/02/2014, 10:20
... banks In total, there were 441 TARP recipients during this time period The Treasury information includes the identity and location of the institution, the date the institution received TARP funds, ... comparable to that of non-TARP banks following the capital infusions This suggests that the small banks may have been able to convert the additional capital into loans without having to lend to riskier ... characteristics of banks’ risk-taking to control more closely for other factors The main hypothesis we want to test is whether the risk ratings of loan originations by TARP banks changed after the...
  • 35
  • 511
  • 0
Tài liệu Báo cáo khoa học: "Different Structures for Evaluating Answers to Complex Questions: Pyramids Won’t Topple, and Neither Will Human Assessors" docx

Tài liệu Báo cáo khoa học: "Different Structures for Evaluating Answers to Complex Questions: Pyramids Won’t Topple, and Neither Will Human Assessors" docx

Ngày tải lên : 20/02/2014, 12:20
... variations in evaluation conditions One direct consequence is that in previous TREC evaluations, the median score for many questions turned out to be zero A binary distinction on nugget importance ... Definition and Other questions are similar in that they both request novel facts about “targets”, which can be persons, organizations, things, and events Relationship questions evolved into the ... Exploration of Alternative Structures Despite the demonstrated effectiveness of nugget pyramids, there are a few potential drawbacks that are worth discussing One downside is that the nugget pyramid...
  • 8
  • 508
  • 0
Ambient particulate air pollution induces oxidative stress and alterations of mitochondria and gene expression in brown and white adipose tissues ppt

Ambient particulate air pollution induces oxidative stress and alterations of mitochondria and gene expression in brown and white adipose tissues ppt

Ngày tải lên : 06/03/2014, 19:20
... TGGCTTGGGTACTCTGTTGTC Ucp1 GGCCTCTACGACTCAGTCCA TAAGCCGGCTGAGATCTTGT Pgc-1a GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT Dio2 AAGGCTGCCGAATGTCAACGAATG TGCTGGTTCAGACTCACCTTGGAA Elovl3 GCCTCTCATCCTCTGGTCCT TGCCATAAACTTCCACATCCT ... within AirCARE is divided into three work areas for: (1) atmospheric monitoring; (2) inhalation exposure systems for laboratory animals (rats or mice); and (3) biomedical laboratory for laboratory ... in WAT raises important questions regarding potential regulatory pathways that may enhance or decrease “brown-fat” like functionality to WAT In conditions of chronic cold exposure white -to- brown...
  • 14
  • 466
  • 0
Uniform t shirts and company uniforms

Uniform t shirts and company uniforms

Ngày tải lên : 11/03/2014, 16:29
... having to be used This adds to wastage of company's capital and therefore can lead to company's loss Shirt producers sign an agreement with the organization authorities on the minimum order basis ... where the customer needs to buy a minimum of specific amount of t shirts It can be the maker to determine the minimum but limit for his or her clients It is crucial for any buyer he must check the ... standard and also the status from the store before purchasing a uniform shirt stock from him The store should have a minimum of a good number of color designs and fashions of uniform shirt to...
  • 2
  • 311
  • 0
BIS Working PapersNo 334Why issue bonds offshore?by Susan Black and Anella MunroMonetary and ppt

BIS Working PapersNo 334Why issue bonds offshore?by Susan Black and Anella MunroMonetary and ppt

Ngày tải lên : 15/03/2014, 07:20
... longer-maturity bonds These bond characteristics tend to be correlated with offshore bond market size The results support the notions that (i) deviations from covered interest parity are actively ... products to investors If the motivations of borrowers dominate those of investors in a current account deficit country, then we would expect the coefficient on the current account to be negative: ... markets; the provision of access to a liquid market for domestic borrowers; better access for resident investors; the tendency for transparency to be greater onshore; and the contribution of a more...
  • 55
  • 702
  • 0
T-­Shirts and Suits A Guide to the Business of Creativity pptx

T-­Shirts and Suits A Guide to the Business of Creativity pptx

Ngày tải lên : 15/03/2014, 21:20
... Listen to customers to find out what they really value about you What is the value to add for customers and your contribution to a better world? Answer the customer’s question ‘What’s in it for ... relation to competitors You may have a particular strength, but if your competitors have it too, or are even better, then it does not give you Competitive Advantage Core Competencies Core Competencies ... going to to achieve our Vision A mission statement is simply a specific description of what the organisation actually does – its contribution to the world and society – so that employees, customers...
  • 117
  • 486
  • 0
Báo cáo khoa học: Investigating RNA polymerase II carboxyl-terminal domain (CTD) phosphorylation ˆ Benoıt Palancade and Olivier Bensaude pptx

Báo cáo khoa học: Investigating RNA polymerase II carboxyl-terminal domain (CTD) phosphorylation ˆ Benoıt Palancade and Olivier Bensaude pptx

Ngày tải lên : 17/03/2014, 10:20
... contributes to the association of the Set1/COMPASS methyltransferase complex onto the 5¢-portion of actively transcribed genes shortly after initiation, thereby enhancing histone H3 K4 trimethylation ... to elongate transcription and contribute to a transcriptional checkpoint: Tat-dependent HIV-1 transcription? ? ? ? Transcription factors, splicing factors, cell cycle regulators [155] only capped ... to the CTD phosphorylated by Ctk1 on serines at position [94,95] Thus, distinct phosphorylated RNAP II isoforms contribute to chromatin imprinting Specific CTD phosphorylation patterns therefore...
  • 12
  • 250
  • 0

Xem thêm