don apos t always keep looking for a status update
LOOKING for a FIGHT IS THERE A Republican War on Science? potx
Ngày tải lên :
22/03/2014, 23:20
... inculcated with notions of ‘balance’ associated with the adage that ‘there are two sides to every story’ As a result, any proposition that is supported by a substantial body of opinion is automatically ... because it’s a sterling example of a book that tells me what I want to hear For the lion’s share of the readers of this blog, it’s what you want to hear, too So take this with a grain of salt ... to that?” It wasn t long before this latitude was abused Rep Senator James Inhofe, the man who called the EPA a “gestapo bureaucracy” and who famously suggested that manmade global warming was...
- 100
- 355
- 0
Báo cáo lâm nghiệp: "Grouping species for predicting mixed tropical forest dynamics: looking for a strategy" pptx
Ngày tải lên :
08/08/2014, 00:22
... quality (dummy variable), BA: stand basal area, OTBA: overtopping basal area 436 20 [57] at = α0 − α1(Bt/B0) + ε t with at: mean diameter increment between t and t + 2, Bt: basal area of the plot ... mortality rate, some authors use the turn-over rate [68], which would suggest that high mortality rates are associated with high recruitment rates Information regarding mortality, and more acutely, ... phenological traits and dynamic variables Their results are consistent with the first preliminary property In their “dynamic data set”, about half the variables are related to size structure and tree mean...
- 12
- 320
- 0
Báo cáo sinh học: "Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance and outcome" doc
Ngày tải lên :
12/08/2014, 17:20
... Clinical and Laboratory Standard Institute: Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard Clinical and Laboratory Standard Institute, ... that these results were from a retrospective analysis and treatment was not standardized Additional, prospective standardized studies are needed to evaluate if in vitro bactericidal tests are ... Laboratory Standard Institute: Performance Standards for Antimicrobial Susceptibility Testing; 18th Informational Supplement M100-S18 Clinical and Laboratory Standard Institute, Wayne, PA; 2008...
- 7
- 356
- 0
Kiến Thức Hàng May Mặc cho Công Tác Quản Lý Đơn Hàng Ngành May - Understanding textiles for a merchandiser
Ngày tải lên :
07/08/2015, 15:15
... natur fbr t i fl t e ept l l s y al i e hat s iament Ther ar t e ew Fiam ent l : l hasconti t nuousI ength t m eanst I h offiam enti equal o the I h ofyar hat he engt l s t engt n AI man- ade ... KnitdekniTex ur yar t t ed n Acc di t t s or ng o he hape oft fiam ent i the yar fl ent yar ar cl sii i o he i sn n, iam ns e as fed nt t t ,fat and bul The fiam ents i a fat yar Ie s r ght and ... y ti ol o he ed Fort ts conduct at i er edi t per ur ,heat a beakerofw at on a hot es ed nt m ate em at es er ae he ume hood,and adj tt t per ur usn at mome er Pl ' us he em at e ig her t ace...
- 653
- 2.1K
- 69
Don’t Be Taken for a Ride Guide to Auto Leasing pdf
Ngày tải lên :
16/03/2014, 12:20
... condition report with both your signature and that of the representative accepting the car, the mileage clearly stated, and a detailed review of the condition of the car at the time that you turn ... lubrication It is typically an after-sell item that requires an additional fee incorporated in the overall lease price or capital cost You can negotiate the cost of the maintenance agreement with the ... should also realize that you have a right to receive important information that is accurate, including the material terms and conditions that will be a part of your lease, without having to endure...
- 29
- 503
- 0
BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx
Ngày tải lên :
30/03/2014, 10:20
... satisfactory quality TAKE CHARGE OF YOUR VISIT TO A GARAGE MAKING COMPLAINTS If you have a complaint, raise it with the garage as soon as possible It’s only fair that they have a chance to deal with ... correct and that it has been correctly stamped The service record book has been stamped with the garage’s stamp and that the relevant details of the service are correct Rather than replacing parts ... AA www.theaa.com Trading Standards Trading Standards services are provided by your local authority For contact details of your local department see your phone book or go to: www.tradingstandards.gov.uk...
- 14
- 352
- 0
Báo cáo y học: "Recently published papers: Clunk-click every trip, smile, but don’t stop for a drink on the way" ppt
Ngày tải lên :
12/08/2014, 20:20
... critically ill medical patients projected to need ventilatory support for more than 14 days to either early percutaneous dilational tracheotomy within 48 hours or delayed tracheotomy at days ... plus a maximum of four intratracheal doses of a recombinant surfactant protein C-based surfactant given within 24 hours They failed to demonstrate any difference between control and treatment groups ... ventilatory support be, particularly during the first 48 hours? We hope that Tracman, the multicentre UK trial that expects to recruit more than 1200 patients, will provide more answers Spragg and...
- 3
- 317
- 0
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt
Ngày tải lên :
18/02/2014, 13:20
... essential aspartates at the b4- and b7-strands) and also from some fishes (lacking the b4-strand aspartate) This may mean that the eventuality of a- glucosidase activity of true rBATs cannot be unambiguously ... (Arthropoda) cluster with both ATG1 and ATG2 (Nematoda), indicating that the hcHAT2 and ATG proteins are orthologues Because hcHAT2 ⁄ ATG 7274 are present only in Arthropoda and Nematoda, they ... domain [2] It is the light subunit that possesses the amino acid transportation activity, although without interacting with the heavy subunit it is unable to reach the plasma membrane Thus, the...
- 14
- 564
- 0
INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt
Ngày tải lên :
31/03/2014, 15:20
... WHAT PROFESSIONAL ANIMATORS SAY IS IMPORTANT ABOUT GETTING A GOOD ANIMATION EDUCATION We asked professional animators about the type of education they got and what they thought was most important ... important to getting started in their animation career Although professional animators got their education in a variety of different ways, they all agreed that in order to really learn animation and ... criteria When we looked at what was most important to potential students about their education by country, Australia, Canada, Germany, the U.S and the UK chose quality of curriculum as their top...
- 14
- 465
- 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
Ngày tải lên :
18/06/2014, 17:20
... necessitated a small sample size to ensure that the quantity of data remained at manageable levels A point of data saturation was quickly reached – the point at which the researcher felt that increasing ... hard to start and start and start again, you know' (Clara, Philippines, 30 s) Frustration stemmed from the fact that there was still a nursing shortage in Ireland, but that the procedures that might ... Return and Onward Migration among Working Age Men In Family and Labour Studies Ottawa: Statistics Canada; 2006 Takenaka A: Secondary Migration: Who Re-Migrates and Why These Migrants Matter Washington...
- 12
- 495
- 0
Báo cáo hóa học: "Research Article Existence of Solutions for a Class of Weighted p t -Laplacian System Multipoint Boundary Value Problems" doc
Ngày tải lên :
22/06/2014, 03:20
... Journal of Inequalities and Applications The study of differential equations and variational problems with variable exponent growth conditions is a new and interesting topic Many results have been ... βi 1− −1 t, w t a −1 a h t m−2 i αi h t dt dt − e1 2.14 Journal of Inequalities and Applications From Lemma 2.1, it is immediate that Λh a1 − Λh a2 , a1 − a2 > 0, for a1 / a2 , 2.15 and hence, ... is a solution of 2.4 with 1.2 , by integrating 2.4 from to t, we find that t w t ϕ t, u t w ϕ 0, u g s ds 2.5 Denote a w ϕ 0, u It is easy to see that a is dependent on g t Define operator t g...
- 18
- 222
- 0
Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx
Ngày tải lên :
09/08/2014, 10:21
... competing interests the collaboration of the staff of the Central Cytometry Laboratory in the Cochin Institute This work was supported by institutional grants from Institut National de la Santé et ... position participates in electrostatic interactions with negatively charged residues of the TCR Alternatively, the ε-amino group can help to render the galactose spatial configuration suitable for TCR ... deglycosylated CII, thus suggesting that they all recognize a carbohydrate carrying epitope Sequential enzymatic cleavages of natural CB11 peptide allowed us to assign the reactivity to a fragment comprising...
- 9
- 318
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
Ngày tải lên :
13/08/2014, 01:20
... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR ... gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology 2011, 8:18 http://www.retrovirology.com/content/8/1/18...
- 21
- 376
- 0
Báo cáo y học: " CD45 immunoaffinity depletion of vesicles from Jurkat T cells demonstrates that exosomes contain CD45: no evidence for a distinct exosome/HIV-1 budding pathway" doc
Ngày tải lên :
13/08/2014, 05:21
... revealed by stripping and staining the blot with capsid (CA) antiserum: the treated samples had somewhat less intense staining CA bands than the untreated material Similarly, the bead fractions ... fractions had CA signal, though at a lower intensity than either the treated or untreated samples, indicating that some CA was removed by depletion, likely due to virus/vesicle aggregates that are formed ... induce the production of vesicles that lack CD45, though this has not been observed It is important to note that, absolute biochemical purity of virion preparations may not be practically attainable...
- 5
- 221
- 0
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
Ngày tải lên :
13/08/2014, 05:21
... characterization of such an adapted strain could greatly facilitate the identification of host determinants that are critical regulators of late phase-steps of HIV replication Methods Animals The ... identified by PCR amplification of a hCycT1-specific sequence in tail biopsy DNA samples (5'primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for ... macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability of HIV-1 to exploit a distinct set of nuclear transcription factors and alternative mechanisms...
- 19
- 263
- 0
MỘT số PHẢN ỨNG HÓA HỌC TẠO RA đơn CHẤT THƯỜNG gặp
Ngày tải lên :
10/09/2014, 13:02
... *phan đ ê ̣ n phân ̉ ng i Đ ê ̣ n phân nong chay i ́ ̉ 2NaCl → 2Na +Cl2 CaCl2 → Ca + Cl2 4NaOH → 4Na + O2 + 2H2O 2Al2O3 → 4Al + 3O2 (xuc tac: Na3AlF6) ́ ́ 6Fe2O3 → 4Fe3O4 ... tac: KOH) ́ ́ *phan kim loa i tac dung v muôi ̉ ng ̣ ́ ̣ i ́ ví du: ̣ Fe + CuSO4 → FeSO4 + Cu Cu + 2AgNO3 → Cu(NO3)2 + 2Ag *phan kh ̉ ng oxit kim loa i: cac oxit cua kim loai trung binh, yêu ... (xuc tac: CuCl2, 400¤C) ́ ́ 4HBr + O2 → 2Br2 + 2H2O 4HBr + MnO2 → MnBr2 + Br2 + 2H2O 2AgCl → 2Ag đen + Cl2 (xuc tac: anh sang) ́ ́ ́ ́ H2S + Cl2 → S + 2HCl 2NaClO → 2NaCl + O2 ( t
- 3
- 15.3K
- 276
Giáo án bồi dưỡng thao giảng, thi giáo viên hoá học lớp 8 Bài 6 Đơn chất và hợp chất - phân tử (20)
Ngày tải lên :
20/05/2015, 17:41
... Kiểm tra 15 ph t Câu (7,5 đ) Trong ch t sau, ch t đơn ch t ? Ch t hợp ch t? Giải thích ? a, Khí ozon t o nên t nguyên t oxi b, Khí amoniac t o nên t nguyên t N H c, P đỏ t o nên t nguyên t ... Bài t p T nh phân t khối c a: a, Khí metan, bi t phân t gồm: 1C 4H b, Khí amoniac, bi t phân t gồm 1N 3H c, Cacbon đioxit bi t phân t gồm 1C, 2O d, Canxi cacbonat, bi t phân t gồm 1Ca, 1C ... Canxi cacbonat t o nên t nguyên t Ca, C O e, Kim loại Magie t o nên t nguyên t Mg Câu (2,5 đ) ? Hợp ch t có phải hỗn hợp không? Vì sao? Mô hình t ợng trưng số mẫu ch t ? Em có nhận x t thành...
- 7
- 301
- 0
Giáo án bồi dưỡng thao giảng, thi giáo viên hoá học lớp 8 Bài 6 Đơn chất và hợp chất - phân tử (13)
Ngày tải lên :
20/05/2015, 17:41
... h a học nào? Những ch t tạo nên t nguyên t h a học trở lên? Những ch t tạo nên t nguyên t hoá học trở lên Ti t: I Đơn ch t : II Hợp ch t: Hợp ch t gì? -Hợp ch t ch t tạo nên t nguyên t ... câu sau: Đơn ch t Ch t phân chia thành hai loại lớn Hợp ch t Và Đơn ch t tạo nên t NTHH Hợp ch t Còn t o nên t hai nguyên t hoá học trở lên Đơn ch t Phi kim Đơn ch t lại chia thành ... Vậy x thuộc nguyên t Đồng Ký hiệu Cu Ch t tạo nên t đâu ? Ch t tạo nên t nguyên t Mỗi loại nguyên t nguyên t hoá học Vậy nói Ch t tạo nên t đâu ? Ch t tạo nên t nguyên t hoá học Ti t: II...
- 17
- 351
- 0
Giáo án bồi dưỡng thao giảng, thi giáo viên hoá học lớp 8 Bài 6 Đơn chất và hợp chất - phân tử (32)
Ngày tải lên :
20/05/2015, 17:41
... Hợp ch t hữu HP CHT .HễùP ch t Đặc điểm cấu to Trong hợp ch t: nguyên t nguyên t liên k t với theo t lệ thứ t định Bi tp: 1) Điền t thích hợp vào chỗ trống: đơn ch t Ch t phân chia thành ... nguyên t Zn Cl c Canxi cacbonat t o nên t nguyên t Ca, C O d Khí ozon t o nên t nguyên t O, e Kim loại natri t o nên t nguyên t Na 3) Nói sau có không? Nếu sai phải nói đúng? a Nước gồm ... có t nh ch t (trừ than chì dẫn điện) Có loại hợp ch t là: hợp ch t .và hợp ch t vô hữu 2) Hãy ch t đơn ch t, hợp ch t, giải thích: a Khí clo t o nên t nguyên t Cl b Kẽm clorua t o nên t nguyên...
- 16
- 270
- 0