... special offering – tea with the orang utan! Of course, the animal was tame and had been trained to sit quietly with human visitors We all, including the teacher, had a good laugh On another occasion, ... had a class gathering at his house James come from a rich family, and lives ina bungalow with a big garden Most of us already know about James’ background because he used to come to school in ... to answer a question by a teacher, his answer often contains a joke or a remark which makes us laugh Usually, because his jokes are funny and not rude, the teacher would laugh along with us James...
... Ala Ala PA Gene constellationa Weaned piglet 2008/6/9 Ha Ha Ala Ala Cla Cla (4-wks) A/ swine/Saraburi/NIAH109713-36/2009 H3N2 B Introduced pig 2009/7/1 Ha Ha Ala Ala Cla Cla (8-wks) A/ swine/Saraburi/NIAH116627-24/2009 ... Valparaiso, Chile Emerg Infect Dis 2010, 16:709–711 18 FAO: FAOSTAT data [http://faostat.fao.org/] 19 Takemae N, Parchariyanon S, Damrongwatanapokin S, Uchida Y, Ruttanapumma R, Watanabe C, Yamaguchi ... to ALa within the Eurasian avian-like swine lineage (Table 2) A/ swine/Saraburi/NIAH116627-24/2009 (H1N1) (Sara116627-24) was isolated in Farm D from a weaned piglet at the age of weeks (Table...
... transfusion In addition, another seronegative lamb was found infected 12 days later This indicates that seronegative lambs may be infected, and that Acta vet scand vol 42 no 4, 2001 serology is not a good ... cause an increase in the IFA-titre, as was also observed in the present work All infected lambs reacted with seroconversion measured 30 days following inoculation Strong serological cross-reactions ... enough to cause fever relapses in the majority of infected lambs In conclusion, the present study indicates that all ages of lambs are of epidemiological importance for the maintenance of E phagocytophila...
... either as top-level managers or as stock associates Top-tier managers included store managers (one Latino man, one black woman), the district manager (an Asian woman), and the regional director (a ... companies seem increasingly willing to present themselves as challenging mainstream appearance standards Several scholars have analyzed how these messages impact consumers (i.e., Johnston and Taylor ... including carpooling, sharing meals at the corner diner, and attending a movie, a baby shower, and a coworker’s funeral I was open with coworkers about my status as a graduate student, and that I was...
... dormant has the same failure rate as an operating one, and it is called ”warm” otherwise • FDEP The FDEP gate has one main input connected to a component or another gate and it has several links ... grant ANR MARMOTE (ANR-12-MONU-0019) References H Boudali, P Crouzen, and M Stoelinga Dynamic fault tree analysis using input/output interactive markov chains In The 37th Annual IEEE/IFIP International ... Kushwaha, A K Verma, and A Srividya Dynamic fault tree analysis using monte carlo simulation in probabilistic safety assessment Rel Eng & Sys Safety, 94(4):872–883, 2009 T Yuge and S Yanagi Quantitative...
... transmutation parameter - the analog of the arrangement energy resolution in QED (Recall that the old renormalization group QCD parameter Λ was also defined by a nonperturbative interaction in the infrared ... constraining QCD as a part, It should be noted, in the theory without ultraviolet divergences the renormalization group equations turn into identities and have no any physical information including ... ∂ν A + [A A ] 2i with the constraint equation equation δS/δAa = has been made in [13] According to this paper the quantization of only the transverse fields AT and the µ fields ψ leads to the...
... Plasmid pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv ... CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope ... (Uppsala, Sweden) All other chemicals were supplied by Sigma-Aldrich (Steinheim, Germany) Antisera against L23 and L29, TF, SufI, and Table Bacterial strains and plasmids used inthis study Strain/plasmid...
... Peters et al [52] in Australia using an LCA analyses considered three scenarios; (1) a sheep meat supply chain in Western Australia, (2) a beef supply chain in Victoria, Australia producing organic ... in the data available to suggest organic dairy systems management is significantly beneficial It must be noted, however, that Canadian and North American data is particularly scarce Sustainability ... offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency...
... terms and formulas of a first-order language L are unambiguous, i.e cannot be read in 4The metalanguage is the language, mathematical English inthis case, in which we talk about a language The theorems ... Replacing α, β, and γ by particular formulas of LP in any one of the schemas A1 , A2 , or A3 gives an axiom of LP For example, (A1 → (A4 → A1 )) is an axiom, being an instance of axiom schema A1 , ... using the connectives and parentheses in particular ways For example, A1 123, (A2 → ( A0 )), and ((( A1 ) → (A1 → A7 )) → A7 ) are all formulas, but X3 , (A5 ), () A4 1, A5 → A7 , and (A2 → ( A0 ) are...
... the acceptance of these inferential procedures as well as their teaching in education remains a challenging task This topic has thus been made a principal aim of analysis and discussion inthis ... of searching databases containing analytical characteristics that serve as a basis for comparative forensic examinations applies also to other kinds or categories of scientific evidence [9] Although ... oppose competing approaches As a starting point, it suffices to note that the prevalent and most well-supported viewpoint is that a database search tends to strengthen a case against a ‘matching’ suspect...
... 5357 an anabolic stimulus, may largely induce increased translation across the board of mRNAs that are already actively being translated How could increased phosphorylation of eIF4E actually inhibit ... phosphorylation in mRNA translation, bearing in mind that the main mechanism governing the actual availability of eIF4E for translation is not its phosphorylation (which probably does not affect its binding ... S.J (2000) Cleavage of polypeptide chain initiation factor eIF4GI during apoptosis in lymphoma cells: characterisation of an internal fragment by caspase-3-mediated cleavage Cell Death Differ 7,...
... Concepts and Axioms Two Straight Lines in Space Straight Lines Perpendicular and Inclined to a Plane Angles Formed by a Straight Line and a Plane 10 Parallelism of a Straight Line and a Plane ... contained inthis plane have a common point, then the latter is a unique point Prove that all straight lines intersecting a straight line a and passing through the point A not lying on the straight line ... a lie in one plane Prove that a straight line intersecting two parallel straight lines lies in the plane containing these lines PROBLEMS IN GEOMETRY 44 274 Straight lines a and b intersect at...
... suggested that this finding is often associated to abnormal gonadotropin levels, lower levels of insulin growth factorbinding protein-1 (IGF-BP1), increased insulin resistance and increased ovarian 17-hydroxiprogesterone ... bilaterally in each subject In particular, ovarian dimensions had been obtained by measuring the main three diameters and applying the ellipsoid formula, and ovarian morphology had been defined ... mean variation between anovulatory and ovulatory PCOS groups was not different in the clinical, hormonal and metabolic parameter evaluated (Table 1) At enrollment, all PCOS patients had bilateral...
... terminated by a tunnel diode and lumped parallel capacitor) [11,13,15,18], vibrating masses attached to an elastic bar [11,12], automatic control, neuro-mechanical systems and some variational problems ... Methods in Mathematical Analysis Transaction on Mathematical Monographs, American Mathematical Society, Providence 1964, 12 14 Hughes DK: Variational and optimal control problems with delayed arguments ... usually call such a delay a distributed delay There are in fact several types of delays The importance of delays has been pointed out by many researchers and we are now witnessing a growing interest...
... patients aged 75 years or over attending the ED: medication in the minors (ambulatory care area) was recognised to be an issue, usually in patients with minor injuries requiring a relatively brief intervention, ... channel blockers Although warfarin is used ina significant number of elderly patients, we were unable to find any drug combinations leading to potential adverse interaction with warfarin usage ... musculoskeletal, cardiovascular, gastrointestinal, neurological and urological disorders Polypharmacy is associated with increases in drug-drug interactions, adverse drug reactions, disease-drug interactions...
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem, ” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Boundary Value Problems 16 C A Santos, “On ground state solutions for singular and semi-linear problems including super-linear terms at in nity,” Nonlinear Analysis: Theory, Methods & Applications...
... Differential and Integral Equations, vol 18, no 12, pp 1321–1332, 2005 M Badiale and S Rolando, A note on nonlinear elliptic problems with singular potentials,” Rendiconti Lincei—Matematica e Applicazioni, ... vanishing at in nity,” Journal of the European Mathematical Society, vol 7, no 1, pp 117–144, 2005 Boundary Value Problems 19 T Bartsch, A Pankov, and Z.-Q Wang, “Nonlinear Schrodinger equations ... procedure to our problem is not trivial at all But since both p- and q-Laplacian operators are involved, careful analysis is needed A typical difficulty for problem 1.1 in RN is the lack of compactness...
... method and an elementary integral inequality In addition, we show that the constants appearing in Hardy inequality are the best Then we conclude a compact embedding in the weighted Sobolev space ... Hardy inequality with remainder terms on Ω, based on the careful Journal of Inequalities and Applications choice of a suitable vector field and an elementary integral inequality Note that we also ... Napoli and J P Pinasco, “Eigenvalues of the p-Laplacian and disconjugacy criteria,” Journal of Inequalities and Applications, vol 2006, Article ID 37191, pages, 2006 [11] J Jaroˇ, K Takaˆi, and...
... method and an elementary integral inequality In addition, we show that the constants appearing in Hardy inequality are the best Then we conclude a compact embedding in the weighted Sobolev space ... Hardy inequality with remainder terms on Ω, based on the careful Journal of Inequalities and Applications choice of a suitable vector field and an elementary integral inequality Note that we also ... Napoli and J P Pinasco, “Eigenvalues of the p-Laplacian and disconjugacy criteria,” Journal of Inequalities and Applications, vol 2006, Article ID 37191, pages, 2006 [11] J Jaroˇ, K Takaˆi, and...
... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that are ... Matematica “Francesco Brioschi”, Politecnico di Milano, Piazza Leonardo Da Vinci 32, Italy; Accademia Nazionale delle Scienze detta dei XL, Via L Spallanzani 7, Italy Email address: marbir@mate.polimi.it ... discontinuous media,” Annali di Matematica Pura ed Applicata Serie Quarta, vol 169, no 1, pp 125–181, 1995 [7] M Biroli, “Nonlinear Kato measures and nonlinear subelliptic Schr¨ dinger problems,”...