do not shift the subject of a sentence or the voice of th

Financial Audit Checklist—Association Cases Selected by Units for Audit Do not send the case file to the Financial Audit doc

Financial Audit Checklist—Association Cases Selected by Units for Audit Do not send the case file to the Financial Audit doc

Ngày tải lên : 20/06/2014, 09:20
... court Affidavit of arrears from CP or other agency Partial Satisfaction of Judgment (PSOJ) All pay histories, financial analysis, Satisfaction of Judgments and affidavits checked above have been ... Copies of all orders including appendixes and supplemental orders on ORAB are contained in the case file Do not send file until all orders have been updated on the system appropriately by the ORDS ... from another state agency or court Grant amounts for public assistance expended prior to the past three (3) years Contact grantarchive@dhw.idaho.gov to request grant information Include the following...
  • 3
  • 301
  • 0
Báo cáo khoa hoc:" Host factors do not influence the colonization or infection by fluconazole resistant Candida species in hospitalized patients" ppsx

Báo cáo khoa hoc:" Host factors do not influence the colonization or infection by fluconazole resistant Candida species in hospitalized patients" ppsx

Ngày tải lên : 11/08/2014, 07:21
... Candida albicans (ATCC 90028), Candida krusei (ATCC 6258), and Candida parapsilosis (ATCC 22019) were used as the standard controls The final growth of each isolate was measured by Biotrak II plate ... Institutional Review Board (IRB) of the National Health Research Institutes Susceptibility tests The MICs to fluconazole were determined according to the guidelines of the Clinical and Laboratory Standards ... into the study Clinical data were recorded on standardized forms and analyzed according to demographic characteristics, hospital unit, duration of stay, predisposing factors, antimicrobial therapy,...
  • 5
  • 295
  • 0
Chương 2: Phân tích độ phức tạp của một số gải thuật sắp thứ tự và tìm kiếm docx

Chương 2: Phân tích độ phức tạp của một số gải thuật sắp thứ tự và tìm kiếm docx

Ngày tải lên : 05/08/2014, 20:21
... ng cách blocks of the file, or the rest of the file, whichever is smaller; sort the in-memory part of the file; write the sorted data to the run file Ri; i = i+1; until the end of the file Trong ... repeat choose the first record (in sort order) among all buffer pages; write the tuple to the output, and delete it from the buffer page; if the buffer page of any run Ri is empty and not end -of- file(Ri) ... M Ta c th d nh trang c a b m cho m i run v d nh ch b nh l i ch a m t trang c a k t qu xu t Gi i thu t ph n tr n run nh sau: ead one block of each of the N files Ri into a buffer page in memory;...
  • 56
  • 475
  • 0
Nghiên cứu phương pháp và quy trình thành lập bản đồ địa chính xã Long Hưng A huyện Lấp Vò tỉnh Đồng Tháp

Nghiên cứu phương pháp và quy trình thành lập bản đồ địa chính xã Long Hưng A huyện Lấp Vò tỉnh Đồng Tháp

Ngày tải lên : 05/09/2016, 05:46
... sau gán vào Gán th ng tin từ nhãn Sau tạo vùng, đánh số th a, ta tiến hành gán th ng tin đ a ban đầu Các th ng tin đ a ban đầu gồm: - Số hiệu - Loại đất - Tên chủ sử dụng, đ a - Diện tích Thao ... soát th c đ a, chỉnh s a bổ sung Trong trình đo th c đ a, số điểm chi tiết đo máy nên ta phải mang vẽ th c đ a để kéo th ước giao hội từ điểm chi tiết có, để dựng cho đầy đủ với th c tế (kèm theo ... tính th ng qua cáp truy ền Từ hình Windows khởi động chương trình Leica Survey Office Ch ọn Data Manager chương tr ình khởi động máy Exchange TC - 307 (hoặc TC – 403) Xuất c a sổ giao diện Data...
  • 37
  • 1.2K
  • 1
Báo cáo y học: "Pollen allergens do not come alone: pollen associated lipid mediators (PALMS) shift the human immue systems towards a TH2-dominated respons" potx

Báo cáo y học: "Pollen allergens do not come alone: pollen associated lipid mediators (PALMS) shift the human immue systems towards a TH2-dominated respons" potx

Ngày tải lên : 08/08/2014, 21:20
... hydrated on the respiratory epithelia, they release allergens and eicosanoid lipids, the so-called pollen-associated lipid mediators (PALMs) Leucotrien-like PALMs have the potential to attract and ... DC maturation and acquisition of a "pro-inflammatory" phenotype [26] In addition, maturation of DCs with LPS in the presence of Bet.-APE impaired the LPS-induced production of the TH1 attracting ... presentation, as well as the expression of co-stimulatory markers are enhanced The DCs acquire a migratory phenotype, serving their mission to transport the sampled antigen to the secondary lymphoid...
  • 6
  • 378
  • 0
Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot

Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot

Ngày tải lên : 13/08/2014, 21:20
... optimal We also hypothesized that high levels of PEEP would increase IAP Materials and methods The study conformed to the regulations of the Australian code of practice for the care and use of animals ... measured parameters at baseline IAP and cmH2O PEEP taken before and during the randomized protocol An adjustment of the values according to the weight of the individual animal did not alter the ... Intensive Care Research Fund We thank Richard Parsons for statistical support We thank the Department of Medical Technology and Physics as well as the team of the Large Animal Facility of the University...
  • 11
  • 406
  • 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx

Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx

Ngày tải lên : 20/12/2013, 23:15
... support of any of these contentions We agree with the Examining Attorney and applicant that the critical question in the case before us centers on the relationship between the goods The marks are ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written ... vitamins The next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company...
  • 8
  • 416
  • 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Ngày tải lên : 18/02/2014, 17:20
... appeared to be more sensitive to NaCl These data are in favour of the idea that trappin-2 (and a fortiori elafin) and SLPI probably provide antimicrobial support to the more powerful epithelial ... cementoin and elafin, which revealed that the antimicrobial activity is independent of the anti-elastase activity because the cementoin domain alone was active [15] The antimicrobial activity of trappin-2 ... Chloramphenicol-2-agar plates The antifungal activity of trappin-2 and its derivative was tested against dormant and activated A fumigatus conidia To prepare dormant (metabolically quiescent) conidia, A fumigatus...
  • 13
  • 610
  • 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Ngày tải lên : 19/02/2014, 17:20
... identified a missense mutation (Ala162Thr) in the TNSALP gene of a patient diagnosed with infantile hypophosphatasia, more than 161 mutations have been reported and of all mutations about 80% of them are ... proteasome pathway TNSALP (D289V), which is associated perinatal hypophosphatasia, is another example [14] These findings suggest that the biosynthesis of TNSALP is under scrutiny of the ER quality ... been reported and classified as the prenatal lethal form, confirming that this mutation represents a severe allele [19] This frameshift mutation is assumed to eliminate the original translational stop...
  • 14
  • 445
  • 0
Tài liệu Báo cáo khoa học: "On Learning Subtypes of the Part-Whole Relation: Do Not Mix your Seeds" pdf

Tài liệu Báo cáo khoa học: "On Learning Subtypes of the Part-Whole Relation: Do Not Mix your Seeds" pdf

Ngày tải lên : 20/02/2014, 04:20
... Proceedings of the Joint Conference of the 4 7th Annual Meeting of the ACL and the 4th International Joint Confe rence on Natural Language Processing of the AFNLP, pages 396–404 Matthew Berland and Eugene ... out that they were unstable, and always correlated with the output of a different specialized set Based on these findings, we believe that the traditional practice of initializing IE algorithms ... acinos-mother of thyme or radarschermradarapparatuur (radar screen - radar equipment, hardly co-occured with reasonable frequency in Wikipedia sentences, hindering pattern extraction We therefore adopted...
  • 9
  • 622
  • 0
The Do’s and Don’ts of Entering a Relationship

The Do’s and Don’ts of Entering a Relationship

Ngày tải lên : 14/03/2014, 14:02
... your partner to do, then you can express this to them before it actually happens and they can decide whether they accept this as fair or not If they do, then there will be no problems as they ... There are certain do s and don’ts that can make or break a relationship that many people just don’t realise The repercussions of actions and words in the early stages of a relationship can manifest ... explain that you understand that this is something they or wear or whatever it may be and that you don’t like it This also works the other way around; you need to let your partner know that they...
  • 86
  • 286
  • 0
THE SENTENCE (A sentence is a group of words which expresses a complete thought.)

THE SENTENCE (A sentence is a group of words which expresses a complete thought.)

Ngày tải lên : 13/07/2014, 23:26
... Sentence A declarative sentenceA declarative sentences make statements or assertions For example:  I shall arrive at there  We must not forget that date 2.An imperative sentence  An imperative ... What Is a Sentence?  A sentence is a group of words which expresses a complete thought  A sentence must contain a subject and a verb (although one may be implied) The Four Types of Sentence ... clauses When a sentence is a single clause, it is called a simple sentence (and the clause is called an independent clause) A sentence must contain at least one independent clause  Below are the...
  • 11
  • 584
  • 0
Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx

Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx

Ngày tải lên : 07/08/2014, 21:20
... all x ∈ X1 In those circumstances we say that G is a k-sum of G1 and G2 Now, we can state the theorem as a consequence of Wagner’s theorem in the following way Theorem 3.2 ([16], see also Theorem ... constants Recall that we introduced the variable q in the equations of the generating functions above to mark the monomial for K5 We can use this variable to obtain a limit law for the number of K5 ... singular expansions by carrying out an analogous calculation as in the proof of Theorem in [7] We only have to adapt for the different Di (y) and Bi (y) One can easily check that the intermediate...
  • 20
  • 248
  • 0
Báo cáo y học: "The treatment of condylar fractures: to open or not to open? A critical review of this controversy" pdf

Báo cáo y học: "The treatment of condylar fractures: to open or not to open? A critical review of this controversy" pdf

Ngày tải lên : 08/08/2014, 17:20
... quality of the available data and the lack of other important information, the question of preferred treatment still remains unanswered, and there is clearly a need for further research The authors ... Journal of Oral and Maxillofacial 1997; 35: 230-6 Talwar RM, Ellis III E, Throckmorton GS Adaptations of the masticatory system after bilateral fractures of the mandibular condylar process J Oral ... internal rigid fixation materials.5 Nevertheless, there is no consensus as regards the treatment of condylar fractures in adults Among themselves, the authors agree that in adults, the type of treatment...
  • 6
  • 433
  • 0
Báo cáo y học: "α Anti-α-fodrin antibodies do not add much to the diagnosis of Sjögren’s syndrome" pot

Báo cáo y học: "α Anti-α-fodrin antibodies do not add much to the diagnosis of Sjögren’s syndrome" pot

Ngày tải lên : 09/08/2014, 01:23
... of the IgG and IgA class, but that their frequency in SjS sera is not higher than that of the classic autoantibodies directed against the Ro60 and La antigens α Analysis for anti-α-fodrin antibodies ... sera also contained anti-Ro and anti-La antibodies (Table 1) From these results we conclude that antiα-fodrin antibodies are present in SjS sera and that the majority of these antibodies are of ... IgA-containing plasma cells of less than 70, a feature that is also strongly associated with SjS and slightly more disease specific than the LFS [13,14] The comorbidity of the six patients with...
  • 6
  • 405
  • 0
Báo cáo y học: "What do we know about communicating risk? A brief review and suggestion for contextualising serious, but rare, risk, and the example of cox-2 selective and non-selective NSAIDs" pot

Báo cáo y học: "What do we know about communicating risk? A brief review and suggestion for contextualising serious, but rare, risk, and the example of cox-2 selective and non-selective NSAIDs" pot

Ngày tải lên : 09/08/2014, 10:23
... or that novel risks have greater impact than those with which we are familiar Man-made risks appear to be worse than natural risks For instance, the risks of radiation are often posed as a major ... is available to allow the appropriate calculations As the rather disparate examples in Figures to show, it is unusual to have a coherent set of data available for a single topic because the amount ... people's attitudes to risk or behaviour might change Page of 16 (page number not for citation purposes) At face value, the idea of placing a catheter in the epidural space alongside the spinal cord does...
  • 16
  • 463
  • 0
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt

Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt

Ngày tải lên : 09/08/2014, 10:23
... infliximab treatment could be that HMGB1 may be more dependent on the IL-1 pathway than the TNF pathway in the pathogenesis of arthritis This theory is also supported by the fact that intra-articular ... β-actin, forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA The volume was adjusted to 15.5 μl using RNase-free ... test was used for the analysis of matched pairs for protein data as well as for the analysis of mRNA data for the whole group Spearman rank sum test was utilised to statistically compare the degree...
  • 8
  • 529
  • 0
báo cáo khoa học: " Survey of smokers'''' reasons for not switching to safer sources of nicotine and their willingness to do so in the future" pdf

báo cáo khoa học: " Survey of smokers'''' reasons for not switching to safer sources of nicotine and their willingness to do so in the future" pdf

Ngày tải lên : 11/08/2014, 18:20
... SAS Institute, Cary, North Carolina) was used for data cleaning and analysis Our analysis methodology called for simply reporting univariate summaries of responses as well as the bivariate analysis ... for reasons other than the real motives of the leaders (such as avoiding ST because of false beliefs about risk, rather than sharing their general despite of tobacco), the short-run results may ... trades workers and a large proportion of the female smokers worked in downtown office buildings The effect of these differences on the variations between the male and female smokers in this sample...
  • 8
  • 361
  • 0
Báo cáo y học: "Are serum cytokines early predictors for the outcome of burn patients with inhalation injuries who do not survive" pot

Báo cáo y học: "Are serum cytokines early predictors for the outcome of burn patients with inhalation injuries who do not survive" pot

Ngày tải lên : 13/08/2014, 11:22
... of inflammatory mediators such as thromboxane, which enhance pulmonary artery pressure and cause secondary damage to the respiratory epithelium and the release of additional mediators, such as ... was used to compare baseline variables Data are expressed as percentages of means ± standard error of the mean, where appropriate Statistical significance was accepted at a P value of less than ... error of the mean *P < 0.05 increased The coefficient for IL-7 was positive, indicating that the risk of mortality increased as the levels of IL-7 decreased The means, standard errors, and Wald...
  • 8
  • 310
  • 0