display 3 1 a predefined function that returns a value 1 of 2
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... identification of the major nuclear matrix proteins Proc Natl Acad Sci USA 19 91, 88 :1 0 31 2 -1 0 31 6 32 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization signal of matrin ... 20 09, 28 :2 2 31 -22 43 20 Marcello A, Lusic M, Pegoraro G, Pellegrini V, Beltram F, Giacca M: Nuclear organization and the control of HIV -1 transcription Gene 20 04, 32 6 :1- 11 21 Marcello A, Ferrari A, ... Pools of siRNAs were obtained from Dharmacon: MATR3 siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1...
- 15
- 470
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... 11 , 26 51 26 65 Taylor NA, Van De Ven WJ & Creemers JW (20 03) Curbing activation: proprotein convertases in homeostasis and pathology FASEB J 17 , 12 15 12 27 Fricker LD, McKinzie AA, Sun J, Curran ... (19 96) Activation of human liver alpha-hydroxysteroid dehydrogenase by sulphobromophthalein Biochem J 31 3, 17 9– 18 4 31 Noriega GO, Juknat AA & Batlle AM (19 92) Non-essential activation of rat liver ... conformational change and oligomerization of hepatitis B virus capsid protein Biochemistry 43, 9989–9998 34 90 30 Matsuura K, Tamada Y, Deyashiki Y, Miyabe Y, Nakanishi M, Ohya I & Hara A (19 96) Activation...
- 10
- 305
- 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
... site-containing primer Mutation Oligonucleotide sequence (5¢ )3 ) C7 3A I9 7A- R9 8A W10 1A F 116 A- L 117 A- L 118 A- G 119 A W16 2A C16 7A D17 7A- D17 9A- F18 1A P 23 3 A- P 23 4 A C 23 6 A E26 4A C27 1A C29 5A W 315 A C 32 6A AAATGAGCCCAACAAAGCCGAGAAAAACATT ... GlcNAcb-pNP and GalNAcb-pNP UDP-Gal UDP-GlcNAc UDP-GalNAc GlcNAcb-pNP Sf9mock b3GalT-I C7 3A I9 7A- R9 8A W1 01 F 116 A- L 117 A- L 118 A- G 119 A W16 2A C16 7A D17 7A- D17 9A P 23 3 A- P 23 4 A C 23 6 A E26 4A C27 1A C29 5A W 315 A ... 16 6 13 1 75 16 0 80 26 5 76 13 3 16 6 88 76 11 5 10 1 93 99 82 11 2 77 12 14 23 13 40 73 15 26 40 33 88 22 65 93 12 72 13 5 14 8 12 9 64 54 76 12 5 12 9 60 66 14 6 67 14 1 13 4 66 12 9 23 8 M Malissard et al (Eur...
- 7
- 404
- 0
Chuong I - ĐẶC ĐIỂM CỦA CÔNG TRÌNH CRESCENT 3.1 – A
... 73 30,5 12 B10 10 6 91 13 B 11 110 ,5 49,5 14 C1 70,5 23 5,5 15 C2 61 30 ,5 16 C3 16 76 22 ,5 17 C4 69,5 27 ,5 32 ,5 18 C5 57,5 22 31 ,5 19 C6 77,5 51, 5 10 ,5 20 C7 78 51, 5 10 ,5 21 C8 80,5 24 ,5 7,5 K1 ... K9 Office 2 91 106 ,2 K10 P.T.Dục 22 0,7 12 8,7 K 11 K.N.Hàng 1 22 0,7 12 8,7 K 12 K.N.Hàng 2 91 106 ,2 K 13 Coffee 1 2 73 14 0 K14 P.M.Tính 60 0 K15 Sảnh 1- T.Tân 33 8,5 35 2, 8 K16 Sảnh 14 1 ,2 90 K17 Coffee 28 8,6 ... 0 ,20 2 15 ,38 0 ,16 7 12 5,4 70/45 Shop,Retail 21 70 0 ,25 4 1, 5 0 ,16 7 12 5,4 75/70 P.T.Dục 21 70 0,845 6,97 0 ,16 7 11 5,4 11 7/ 13 3 P.Máy tính 21 70 0,5 53 12 0 ,16 7 12 21 4 87/ 63 K.Thương Mại 21 70 0 ,20 2...
- 10
- 1,358
- 3
Lab 3.1.5 Configuring a Serial Interface
... Verify that the serial connection is functioning a ping the serial interface of the other router BHM#ping 19 2 .16 8 .15 .1 GAD#ping 19 2 .16 8 .15 .2 b From GAD, ping the BHM router serial interface Does ... to Interface Summary GAD(config)#interface serial GAD(config-if)#ip address 19 2 .16 8 .15 .1 25 5 .25 5 .25 5.0 GAD(config-if)#clock rate 56000 GAD(config-if)#no shutdown GAD(config-if)#exit GAD(config)#exit ... #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1)...
- 5
- 341
- 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx
... (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 25 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 26 00 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0 (S0/0) Serial 0 /1 (FA0/0) (S0 /1) ... completion of the previous steps, logoff by typing exit Turn the router off Remove and store the cables and adapter 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1. 5 Copyright 20 03, Cisco ... Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0)...
- 5
- 535
- 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc
... Verify that the serial connection is functioning by pinging the serial interface of the other router London#ping 19 2 .16 8 .15 .2 Paris#ping 19 2 .16 8 .15 .1 a From London, can you ping the Paris router’s ... interface serial 2- 6 CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright 20 03, Cisco Systems, Inc This will show the details of interface serial Answer the following questions: a Serial is ... the router off • 4-6 Logoff by typing exit Remove and store the cables and adapter CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router...
- 6
- 368
- 0
Trờng THPT Quế Võ số 1 -Kỳ thi: Thử Đại học lần 3 - Khối A - Lớp 12 - 201
... gam 23 , 4 gam B 9 ,2 gam 13 , 8 gam C 9 ,2 gam 22 ,6 gam D 23 , 4 gam 13 , 8 gam Câu 39 : Ôxi h a lượng Fe thành hỗn hợp X gồm FeO , Fe3O4 , Fe2O3 cần a mol O2 Khử hoàn toàn hỗn hợp X thành Fe cần b mol Al ... lượng 1, 6 gam có tỷ khối hydro 20 CTĐGN X A C2H6O5N2 B C3H10O3N2 C C4H10O5N2 D C3H8O5N2 Câu 46: H a tan a gam oleum H2SO4.3SO3 vào 10 0 gam dung dịch H2SO4 10 % thu oleum có phần trăm khối lượng SO3 ... thành 2, 4,6-tribrom clorua toluen.; Những câu là: A 1, 2, 3, B 1, 3, C 1, 2, 3, 4, D 1, 2, Câu 15 : Cho phản ứng: (1) O3 + dung dịch KI ; (2) F2 + H2O ; (3) MnO2 + HCl (to) ; (4) Cl2 + dung dịch H2S...
- 4
- 319
- 2
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx
... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2- 2 CCNA 1: Networking Basics v 3. 0 - Lab 3. 1. 1 Copyright 20 03, ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...
- 2
- 392
- 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc
... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2- 2 CCNA 1: Networking Basics v 3. 0 - Lab 3. 1. 1 Copyright 20 03, ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...
- 2
- 374
- 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt
... (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 25 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 26 00 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0 (S0/0) Serial 0 /1 (FA0/0) (S0 /1) ... completion of the previous steps, logoff by typing exit Turn the router off Remove and store the cables and adapter 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1. 5 Copyright 20 03, Cisco ... Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0)...
- 5
- 431
- 0
Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc
... ACE -20 0 ACE-400 Size (HxWxD) 35 x16x14 39 x24x16 51x30x 22 53x55x 23 Serving Area Size 32 -14 4 homes 32 - 21 6 homes 32 -576 homes 32 -11 52 homes Mounting Aerial or ground Aerial or ground Ground only Ground ... 1x16 1x 32 Specifications not include 2dB connector loss Web Site: www.adc.com From North America, Call Toll Free: 1- 800 -36 6 -38 91 • Outside of North America: +1- 9 52- 938 -8080 Fax: +1- 9 52- 917 - 32 37 ... only Splitter Configurations Standard Splitters 1x4 1x8 1x16 1x 32 Max loss 7.3dB 10 .70dB 14 .00dB 17 .40dB Typ loss 6.2dB 9.80dB 13 . 20 dB 16 .50dB Uniformity 1. 40dB 1. 00dB 1. 50dB 2. 00dB Return Loss...
- 4
- 242
- 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf
... Verify that the serial connection is functioning by pinging the serial interface of the other router London#ping 19 2 .16 8 .15 .2 Paris#ping 19 2 .16 8 .15 .1 a From London, can you ping the Paris router’s ... interface serial 2- 6 CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright 20 03, Cisco Systems, Inc This will show the details of interface serial Answer the following questions: a Serial is ... the router off • 4-6 Logoff by typing exit Remove and store the cables and adapter CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router...
- 6
- 323
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... Q8XEG2c Q8FBT4 P1 716 9 Q0TKK5 P 0A 915 P0AFG6 16 )1. 66 )2. 50 57 33 )1. 50 )2. 00 17 33 )1. 60 )2. 22 11 10 29 50 30 +3. 08 )1. 50 )2. 08 +2. 51 +2. 07 )1. 92 a The MASCOT score represents the probability that ... succinyltransferase component of 2- oxoglutarate dehydrogenase complex Scorea No of matching peptides Sequence coverage (%) 17 2 17 70 72 12 4.76 ⁄ 39 .33 5.56 ⁄ 67. 13 6 13 5 1 23 13 17 5.56 ⁄ 67. 13 6 12 5 ... 41, 11 9 21 11 930 23 Mangoni ML & Shai Y (20 09) Temporins and their synergism against Gram-negative bacteria and in lipopolysaccharide detoxification Biochim Biophys Acta 17 88, 16 10 16 19 24 Maisetta...
- 18
- 494
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... (M )1 s )1) SE (Kon) Koff (s )1) SE (Koff) KD (M) 7.00 · 10 4 4. 93 · 10 5 6 .35 · 10 5 1. 7 · 1 03 3.9 · 1 03 8 .3 · 1 03 1. 28 · 10 )2 8 .25 · 10 )3 6. 63 · 10 )4 1. 2 · 10 )4 9.0 · 10 )5 1 .3 · 10 )5 1. 83 · 10 )7 1. 68 ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...
- 11
- 679
- 0
Tài liệu tiếng Anh session 1 chapter 3 Seveloping a process strategy
... (wd) 1, 3 1, 6 18 1, 15 1, 12 12 1, 10 20 10 2, 16 2, 2 1 2, 1 2 3, 6 3, 27 4, 2 5, 2 3 Total 11 2 Total 82 Example 3. 1 Excel Solver evaluation of solution Application 3. 2 Matthews and Novak Design ... Application 3. 2 Department Pair Closeness Factor Distance Score 1, 16 5 16 5 25 0 3, 12 5 12 5 3, 12 5 2, 10 5 10 5 5, 10 5 10 5 18 0 1, 90 1, 25 75 4, 25 25 Total 1 030 Based on the above results, propose a ... rectilinear distance and complete the highlighted cells Department Pair Closeness Factor Distance Score 1, 16 5 16 5 25 0 3, 12 5 12 5 3, 12 5 2, 10 5 10 5 5, 10 5 10 5 18 0 1, 90 1, 25 75 4, 25 25 Total 1 030 Application...
- 47
- 512
- 0
báo cáo hóa học: " A case report of acute dermatitis that developed during an experiment examining the bromination of 3-hexylthiophene" potx
... NA NA 18 0 -1 83 + + 3- Hexylthiophene 65 37 NA + + 2- Bromo-3hexylthiophene NA 11 0 NA NA + Chloroform 62 NA -64 + + Acetic acid 11 8 39 16 .7 + + NA: Not available The likely aetiology of the acute ... Contact dermatitis In: Saunders Manual of Medical Practice Philadelphia, London, Toronto, Montreal, Tokyo W.B.Saunders 19 96, 924 - 925 16 Trattner A, David M, Lazarov A: Occupational contact dermatitis ... essential oils Contact Dermatitis 20 08, 58 :28 2 -28 4 doi :10 .11 86 /17 45-66 73- 5 -3 Cite this article as: Sato et al.: A case report of acute dermatitis that developed during an experiment examining...
- 4
- 312
- 0
Báo cáo sinh học: " Research Article Aλ3 λ1 , λ2 , Ω -Weighted Inequalities with Lipschitz r and BMO Norms" doc
... /s 3 B ≤ 1/ 1 λ w1 m, 3 B m 3 B w2 1/ m dx α 3 r 1 /s 2 / r 1 w2 3. 15 dx α 3 /s 2 1/ r 1 , 3 B Since w1 , w2 ∈ A 3 1 , 2 , Ω , then r α/s λ w1 1, 1 B w2 · 2 α 3 /s 1/ r 1 , 3 B ⎡ ≤⎣ 3 B ... 1/ r 1 , 2 B Since w1 , w2 ∈ A 3 1 , 2 , Ω and m−t /mt α 3 r 1 /s α/s r combining with 3. 22 , 3. 23 , 3. 24 , and 3. 25 , we have G u −G u ≤μ B 3. 26 dx α 3 /s 2 w2 α 3 r 1 /s 2 / r 1 w2 2 B ... ≤ C 12 sup |B| 1 u − uB σ4 B⊂Ω C 12 u α 2 3 /s ,Ω,w2 α 2 3 /s 1, 3 B,w2 3. 19 α 2 3 /s 1, 3 B,w2 α 2 3 /s 1, 3 B,w2 , where σ4 > 3 is a constant and σ4 B ⊂ Ω We have completed the proof of...
- 14
- 275
- 0
Bản lề của 3 châu Á-Phi-Âu 1 doc
... ch a nhiều suối "vàng đen", tức dầu l a Từ năm 1 930 , kỹ sư Mỹ kiếm nhiều mỏ dầu Haradh, Ghawar, Abgaid, Qua-tif, ph a gần vịnh Ba Tư, mỏ Bahrein đảo vịnh, gần bán đảo Khatar, thuộc tỉnh Hasa vương ... giống Saudi) Yemen Aden Hadramaout Oman Aden nhỏ nhất, tỉnh thuộc đ a Anh, nằm Yemen, vịnh Aden Diện tích: 35 .000 số vuông, dân số khoảng n a triệu Mấy năm trước, Anh tính rút quân khỏi đ a đầu ... Ả Rập Saudi Năm 19 47, sức sản xuất giếng dầu Hasa tới 41 triệu lít ngày Cuối năm 19 50, số tăng lên gấp đôi Đào sâu thêm n a, xuống tới 1. 000, 1 .35 0 thước, người ta thấy lớp dầu đương khai thác...
- 6
- 197
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu