disease serum uric acid as a predictor of outcomes in acute myocardial infarction

báo cáo hóa học:" Depression as a predictor of work resumption following myocardial infarction (MI): a review of recent research evidence" doc

báo cáo hóa học:" Depression as a predictor of work resumption following myocardial infarction (MI): a review of recent research evidence" doc

Ngày tải lên : 20/06/2014, 16:20
... Cardiovascular disease; CHD: Coronary Heart Disease; CAD: Coronary Artery Disease; OR: Odds ratio; HR: Hazard Ratio; MMPI: Minnesota Multiphasic Personality Inventory; QOL: Quality of Life Additional ... status, income Chronic disease Myocardial Infarction, Acute Coronary Syndrome, Cardiovascular disease, Coronary Heart Disease, Coronary Artery Disease, depression, psychological distress, morbidity, ... Intervention (PCI) and stents, overall rates of revascularization (substantially increasing since 1993 [18]), and increased medication prescription [aspirin, Angiotensin-converting enzyme (ACE) inhibitors]...
  • 11
  • 494
  • 0
Báo cáo y học: " The utility of the Historical Clinical Risk -20 Scale as a predictor of outcomes in decisions to transfer patients from high to lower levels of security-A UK perspective" pptx

Báo cáo y học: " The utility of the Historical Clinical Risk -20 Scale as a predictor of outcomes in decisions to transfer patients from high to lower levels of security-A UK perspective" pptx

Ngày tải lên : 11/08/2014, 16:22
... records in the Offenders Index of the Home Office A reconviction was regarded as being “serious” in cases of murder, manslaughter, assault, rape, indecent assault towards adult male, adult female ... work, assisted in data analysis and assisted in drafting the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... in the North of England has adopted this instrument into routine clinical practice following a series of research based validation studies to examine its utility as part of its ongoing risk assessment...
  • 8
  • 388
  • 0
báo cáo khoa học: "Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature" pot

báo cáo khoa học: "Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature" pot

Ngày tải lên : 11/08/2014, 02:21
... is available for review by the Editor -in- Chief of this journal Abbreviations ALB: albumin; AN: anorexia nervosa; AST: asparate aminotransferase; ALT: alanine aminotransferase; BCAA/AAA: branch-chain ... higher than that of the spleen in a patient with AN and elevated transaminases, whereas liver steatosis was diagnosed in ultrasound imaging, as was found in our patient In addition, these authors ... magnetic resonance imaging, and magnetic resonance angiography of the head showed no abnormality Aspartate aminotransferase was 3194 IU/L (reference range, to 38 IU/L); alanine aminotransferase,...
  • 4
  • 410
  • 0
Báo cáo y học: "Delirium as a predictor of sepsis in post-coronary artery bypass grafting patients: a retrospective cohort study" docx

Báo cáo y học: "Delirium as a predictor of sepsis in post-coronary artery bypass grafting patients: a retrospective cohort study" docx

Ngày tải lên : 13/08/2014, 21:21
... serving the province of Manitoba Data collection and variable selection The Maritime Heart Center Cardiac Surgery Registry and the Manitoba Cardiac Surgery Database are detailed clinical databases ... pulmonary disease; CVD: cerebrovascular disease; EF: ejection fraction; ICU: intensive care unit; LOS: length of stay; MI: myocardial infarction; OR: odds ratio; PVD: Peripheral Vascular Disease; ... Main disease nosocomial pneumonia and the subsequent development of sepsis [11] Delirium has also been associated with removal of catheters, resulting in increased instrumentation of the urinary...
  • 6
  • 305
  • 0
Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx

Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx

Ngày tải lên : 10/08/2014, 09:22
... obstructive pulmonary disease, CrCl = creatinine clearance, PVD = peripheral vascular disease, Hb = hemoglobin, IMA = internal mammary artery, MI = myocardial infarction, IABP = intra-aortic balloon pump ... complaint of only pain, unstable angina, and a Canadian and New York Heart Association class lower than IV Case selection has been shown to be an important factor in achieving a favorable outcome after ... fraction, NYHA = New York Heart Association, COPD = chronic obstructive pulmonary disease, MI = myocardial infarction, CrCl = creatinine clearance, PVD = peripheral vascular disease *Data are...
  • 8
  • 358
  • 0
báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

Ngày tải lên : 10/08/2014, 22:20
... groupings, a univariate relative risk of death was calculated for each iron parameter using hazard regression analysis Survival time was measured from the date of transplant to the date of death or last ... represents a or AML indicates acute myeloid leukemia; ALL, acute lymphoblastic leukemia; MDS myelodysplastic syndrome; AA, aplastic anemia plant echocardiogram or MUGA scan All measures of EF were ... American Laboratory Products Company, Windham, NH The kit shows no cross-reactivity against albumin, lysozyme, alpha-1 antitrypsin and other acute phase proteins Values for aspartate transaminase...
  • 9
  • 320
  • 0
Báo cáo y học: "Plasma DNA concentration as a predictor of mortality and sepsis in critically ill patients" pptx

Báo cáo y học: "Plasma DNA concentration as a predictor of mortality and sepsis in critically ill patients" pptx

Ngày tải lên : 12/08/2014, 23:23
... this was an observational study looking at plasma DNA, a new variable measured from blood samples that were taken as part of standard clinical practice All blood samples were taken from indwelling ... differentiate between cerebral infarction and haemorrhage, suggesting that a wide range of insults may increase levels of circulating DNA It appears that circulating DNA in patients with cancer is almost ... hospital mortality A univariate analysis was performed to compare various factors as predictors of mortality (Table 3) At intensive care admission, the SOFA score and the plasma DNA concentration were...
  • 7
  • 280
  • 0
Báo cáo y học: "Vestibulo-ocular monitoring as a predictor of outcome after severe traumatic brain injury" pot

Báo cáo y học: "Vestibulo-ocular monitoring as a predictor of outcome after severe traumatic brain injury" pot

Ngày tải lên : 13/08/2014, 20:21
... Saatman KE, Duhaime AC, Bullock R, Maas AI, Valadka A, Manley GT: Classification of traumatic brain injury for targeted therapies J Neurotrauma 2008, 25:719-738 21 Rappaport M, Hall K, Hopkins ... Subdural haematoma, Epidural haematoma, Traumatic subarachnoid haemorrhage, skull fracture, skull base fracture, Spine fracture Fentanyl, remifentanyl, midazolam, propofol, esketamin, thiopental induced ... Subdural haematoma, Epidural haematoma, Traumatic subarachnoid haemorrhage, skull fracture, skull base fracture, spine fracture Fentanyl, remifentanyl, midazolam, propofol, ketamin, esketamin,...
  • 10
  • 416
  • 0
Báo cáo y học: " In vitro bioassay as a predictor of in vivo response" pdf

Báo cáo y học: " In vitro bioassay as a predictor of in vivo response" pdf

Ngày tải lên : 13/08/2014, 22:22
... used equation (8) as the incoming signal, substituted this into equations (6) and (7) and solved analytically using Math Cad graphing software (MathSoft Inc., Cambridge, MA, USA) to predict in vivo ... proportion of "free" BAS (see Methods) For equation (6) the value of this maximum is increasing as β increases; for equation (7) this value is maximum for mid-range β values BIPHASIC PATTERNS OF BIOLOGICAL ... biological response On the other hand, in many tumour disorders the concentrations of binding proteins are changed For example, in ovarian carcinoma the changes of sex binding protein and ratio...
  • 8
  • 251
  • 0
Báo cáo y học: " Statistical distribution of blood serotonin as a predictor of early autistic brain abnormalities" ppt

Báo cáo y học: " Statistical distribution of blood serotonin as a predictor of early autistic brain abnormalities" ppt

Ngày tải lên : 13/08/2014, 23:20
... biological regulation of 5-HT release in the gut is simple The human gut is a remarkably complex organ that uses a wide range of neurotransmitters and that may have at least as many neurons as the ... A biological factor that causes autism may have a dual A biological factor that causes autism may have a dual function A factor that causes autism (shown in red) may be expressed (1) in the CNS, ... hypothesis assumes that EC cells can monitor (directly or by way of gastrointestinal neurons) the 5-HT levels in the surrounding extracellular space and can decrease or increase their 5-HT release accordingly...
  • 16
  • 393
  • 0
Thuyết trình The Term Structure as a Predictor of Real Economic Activity

Thuyết trình The Term Structure as a Predictor of Real Economic Activity

Ngày tải lên : 14/07/2015, 11:45
... with maturities that range from one to 12 months and finds that most of the information in forward rates is about future real rates of interest  Fama (1990) finds that an increase in the spread ... use average quarterly data as opposed to point in time data Previous investigators have used beginning of period data primarily because the implicit forward interest rates match a future spot rate ... information variables that we choose are the recent growth in the index of leading indicators, the lagged growth in real output, and the lagged rate of inflation  The index of leading indicators is...
  • 51
  • 474
  • 0
Báo cáo y học: "Role of resistin as a marker of inflammation in systemic lupus erythematosus" ppsx

Báo cáo y học: "Role of resistin as a marker of inflammation in systemic lupus erythematosus" ppsx

Ngày tải lên : 09/08/2014, 10:22
... regression analyses as independent variables and resistin as a dependent variable A forward stepwise method was used ESR and S-creatinine were defined as normal or pathological according to standard laboratory ... variables Analyses were also performed with z score total hip and radius as dependent variables using a cutoff value as -1 SD for normal or reduced bone mass Resistin was significantly associated ... lupus erythematosus An association between resistin and inflammation has been reported in several different diseases, including RA [21] and inflammatory bowel disease [5], but is very weak or nonexistent...
  • 9
  • 460
  • 1
Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

Ngày tải lên : 11/08/2014, 12:20
... hemoperitoneum An acute intra-abdominal bleed from the liver metastatic disease was diagnosed Our patient had an esophageal gastro-duodenal endoscopy as he had been taking aspirin and had a past history of ... Dewar GA, Griffin SM, van Hasselt CA, et al.: Fatal haemoperitoneum due to liver metastases from nasopharyngeal cancer Aust N Z J of Surg 1991, 61(9):723-725 Yoshida H, Mamada Y, Taniai N, et al.: ... to be of metastatic disease within the liver (Figures 1, 2, No primary tumor was identified A diagnostic peritoneal tap was performed and frank blood was aspirated confirming that there was hemoperitoneum...
  • 3
  • 372
  • 0
Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt

Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt

Ngày tải lên : 12/08/2014, 13:22
... variables measured at day 1, day 6, and the change in value between day and Stata 9.0 (StataCorp, College Station, Texas) computer software was used for statistical analysis All interval data ... http://respiratory-research.com/content/12/1/52 Page of Figure Trends in measures of oxygenation, respiratory compliance and acid base balance during the first days of mechanical ventilation for acute lung injury Data are shown as mean ± ... compliance, BD, PaO2/FiO2, age, gender, COPD, pneumonia, vasopressors, APACHEII In the multivariate analyses (Table 3), as in the bivariate analyses, OI was the only variable associated with death...
  • 8
  • 351
  • 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Ngày tải lên : 12/08/2014, 17:22
... Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene ... biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the design of ... Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated discs was normalized to saline-treated discs Biochemical analysis...
  • 9
  • 402
  • 0
Báo cáo y học: "Myocardial Doppler velocities as a marker of prognosis in the ICU" pot

Báo cáo y học: "Myocardial Doppler velocities as a marker of prognosis in the ICU" pot

Ngày tải lên : 13/08/2014, 08:20
... J, Papakostas L, Tahta SA, Hardy BG, Bollen BA, Duran CM, Levine RA: Mechanism of recurrent ischemic mitral regurgitation after annuloplasty: continued LV remodeling as a moving target Circulation ... differences in diastolic mitral annular motion as exemplified with E’ Whereas Doppler myocardial imaging allows more precise discrimination of the phase of diastolic dysfunction, Sturgess et al clearly ... Ylitalo A, Stolen KQ, Kalliokoski R, Nekolla SG, Bax KE et al: Assessment of right ventricular oxidative metabolism by PET in patients with idiopathic dilated cardiomyopathy undergoing cardiac...
  • 2
  • 262
  • 0
Báo cáo y học: "Diarrhea as a cause of mortality in a mouse model of infectious colitis" ppt

Báo cáo y học: "Diarrhea as a cause of mortality in a mouse model of infectious colitis" ppt

Ngày tải lên : 14/08/2014, 20:22
... performed on transformed data A p-value < 0.05 was regarded as statistically significant Abbreviations A/ E, attaching and effacing; AP, activator protein; AQP, aquaporin; CA, carbonic anhydrase; CFTR, ... anhydrases CA I and CA IV and aquaporins Aqp4 and Aqp8 [78-80] These results indicate that infectious diarrhea and noninfectious inflammationassociated diarrhea may have common mechanisms of pathogenesis ... for Assessment and Accreditation of Laboratory Animal Care and maintained on pelleted rodent chow (LabDiet, Purina Mills, Inc., Richmond, IN, USA) and water ad libitum At 12 weeks of age, infectious...
  • 19
  • 300
  • 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

Ngày tải lên : 16/07/2015, 07:45
... ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... other language skills in general and for writing skill in particular, classroom assessment can be understood as “an on-going process aiming at understanding and improving students’ learning” (Angelo ... understandings by employing a diverse array of methods, including those that call for actual performance, using them over time so as to reveal change, growth, and increasing degrees of integration...
  • 65
  • 893
  • 7
Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

Ngày tải lên : 30/11/2015, 09:14
... STATEMENT OF AUTHORSHIP Title: Students’ Perceptions of Using Portfolios as a Means of Evaluation in an English Foreign Language Translation Course, a Case Study at the Faculty of Foreign Languages, ... ABSTRACT The purpose of this study is to investigate students’ perceptions of benefits of using portfolios as a means of evaluating their learning process in a translation course and find ... Languages, Hanoi Pedagogical University N02” (Graduation paper submitted in partial fulfillment of The Degree of Bachelor of Arts in English) I certify that all the materials in this study has...
  • 7
  • 361
  • 1
báo cáo hóa học:" Quality of life after acute myocardial infarction: A comparison of diabetic versus non-diabetic acute myocardial infarction patients in Quebec acute care hospitals" pdf

báo cáo hóa học:" Quality of life after acute myocardial infarction: A comparison of diabetic versus non-diabetic acute myocardial infarction patients in Quebec acute care hospitals" pdf

Ngày tải lên : 20/06/2014, 15:20
... Cobb LA: Health status of survivors of cardiac arrest and of myocardial infarction Am J Pub Health 1985, 75:1321-1323 Agarwal M, Dalal AK, Agarwal DK, Agarwal RK: Positive life orientation and ... Procedures at baseline Angiography Angioplasty Bypass surgery Revascularization Time to angiography (median days) Characteristics of angiography Diseased coronary vessels None One Two Three Left main ... TG, Pfeffer MA, Braunwald E, Investigators CARE: Cardiovascular events and their reduction with pravastatin in diabetic and glucose-intolerant myocardial infarction survivors with average cholesterol...
  • 6
  • 462
  • 0