discuss the guidance role of a primary school teacher
Trial test for the final examination of upper primary school
... a large open field, despite the fact that Manila has many stadiums The organization decided to hold the games at an open space to accommodate the large number of participants and spectators As ... in class is taller than Dave A Dave is the tallest student in the class B Dave is taller student in the class C Dave is the taller student in the class D Dave is tallest student in the class 50.I ... comes back B Sarah asked us not leave until she came back C Sarah told us not to leave until she came back D Sarah said to us not to leave until she comes back 47.I haven’t had an umbrella with...
- 3
- 692
- 0
Change and continuity in the culture of singapores primary school teachers from 1959 to 2006
... time, and as a consequence, teachers emerged each of the core elements of their culture that became institutionalized as part of the teacher cultural field and inscribed and naturalized in the teacher ... the teachers’ work situation via a strategic agency such as the Ministry of Education which acts as an “authoritative relay” to shape the conditions and situations of other agencies such as schools; ... Furthermore, although Althusser accords an important role to the state, his structuralist formulations of the state as a factor in the cohesion of a class divided capitalist society and as part of state...
- 391
- 341
- 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
... permit the unmasking of radical intermediates that rearrange at a rate faster than that of the recombination step [16,93] Despite the apparent predominance of the hydrogen transfer mechanism as the ... [68], the enzyme variant still mediated N-oxygenation of the tertiary arylamine at a rate less than half that of the wild-type-catalyzed reaction [142], so that reasonable interpretation of the data ... higher rates than usual radical rearrangements [98,312] On the other hand, the timing of radical rearrangement (radical clocks) may depend critically on the tightness of the radical cage and the...
- 26
- 746
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... structure of the protein Figure shows the fluorescence spectra of wild-type SNase and the four mutants E142O, K13 3A, W14 0A and W140O The fluorescence spectra of E142O and K13 3A are similar to that of the ... average conformation of denatured proteins Here we show that a specific single mutation or removal of a specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent ... curves of the wild-type protein and the mutants K13 3A, E142O, W14 0A and W140O are shown in Fig 3, with their thermodynamic parameters summarized in Table The calorimetric DHcal values 3961 Staphylococcal...
- 7
- 551
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation of mutant and wild-type...
- 6
- 488
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... in accordance with the prediction that substrate-binding raises the pKa of Glu144 Tyr10 and Ser93 To our knowledge, there are no other mutational data in the literature that address the role of...
- 10
- 651
- 0
Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc
... Both the Public Company Accounting Oversight Board (PCAOB) and the International Auditing and Assurance Standards Board (IAASB) have launched initiatives to reexamine the auditor’s report, and as ... audits of the financial statements and internal control over financial reporting Participants agreed that the audit does have value in providing reasonable assurance whether the financial statements ... explore areas where change may be appropriate, the CAQ formed a task force on the role of the auditor and moved to convene investors and other financial reporting stakeholders to examine the role of...
- 20
- 388
- 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx
... this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ ... response At sites of DNA damage, the Ser129-phosphorylated H2AX derivative, cH2AX, forms foci for the recruitment of factors involved in repair of DNA damage and maintenance of the cell cycle arrest ... in the appearance of a ‘smear’ of low molecular mass DNA species that may represent some chromosome degradation (Fig 5, psy4D, h) When WT cells were washed free of the DNA-damaging agents and allowed...
- 11
- 362
- 0
Báo cáo lâm nghiệp:" The key-role of topsoil moisture on CO2 efflux from a Mediterranean Quercus ilex forest" docx
... Several data are available on the respiration of Mediterranean ecosystems Most of them were measured in the Mediterranean Basin [4, 5, 10, 15, 26, 32, 37, 38] Some other data dealing with Australian ... moisture at the same time, assumed that the effects are multiplicative whereas some of them let vary the effect of temperature with soil moisture [9, 37] The seasonality of Mediterranean climates characterised ... Australian ecosystems under Mediterranean climate are also available [12, 29] They all highlight the effect of the summer drought on soil respiration and some of them also show the negative effect of...
- 8
- 371
- 0
Báo cáo khoa học: "Hepatic splenosis mimicking HCC in a patient with hepatitis C liver cirrhosis and mildly raised alpha feto protein; the important role of explorative laparoscopy" potx
... demonstrating a solitary cm hypervascuArterial (A) segment venous phase Arterial (A) and portal venous phase (B) of IV Gadlinium enhanced axial MRI images demonstrating a solitary cm hypervascular ... scan1 CT scan (A) Axial IV contrast enhanced CT Arterial phase image showing a × 2.7 cm hypervascular, subcapsular nodule in segment VII of the liver (B) Portal venous phase image Page of (page ... investigation of this lesion, and better assessment of the extent of the disease Diagnostic laparoscopy demonstrated a cm exofitic dark brown splenunculus attached to the diaphragm and indenting the...
- 4
- 451
- 0
Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps
... trees Therefore cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage of the central and ... Cases of Solitary Pulmonary Nodule Radiation Medicine 2003, 21:267-271 20 Ohono K, Miyoshi S, Minami M, Akashi A, Maeda H, Nakagawa K, Matsumura A, Nakamura K, Matsuda H, Ohashi S: Ipsilateral ... not in the surgical field, the suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters...
- 5
- 657
- 0
Báo cáo y học: "Chronic whiplash and central sensitization; an evaluation of the role of a myofascial trigger points in pain modulation" docx
... conclusions and those of prior authors, that algometry of both symptomatic and asymptomatic body sites may have a practical clinical application in the contemporary evaluation of treatment success ... returned to baseline over a matter of hours to several days Discussion The present data demonstrate a remarkably rapid change in central sensitization symptoms following the anesthetizing of painful ... in litigation and no reasonable interpretation of the present data allows for any attribution of the observations to financial motivation or emotional liability The number of subjects in the present...
- 8
- 531
- 1
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
... multivariate analysis of cancer-related survival in the total populationa Risk factor Multivariate analysisc Univariate analysis p valueb R-status Masaoka stagingd Presence of a pseudocapsula WHOd classificatione ... Okumura M, Ohta M, Tateyama H, Nakagawa K, Matsumura A, Maeda H, Tada H, Eimoto T, Matsuda H, Masaoka A: The World Health Organization histologic classification system reflects the oncologic behavior ... case each in patients with an incomplete encapsulated thymoma or a missing capsula Neo-Adjuvant and Adjuvant Therapy As far as a neoadjuvant or adjuvant therapy is concerned two major aspects...
- 10
- 355
- 0
Báo cáo y học: " A solitary primary subcutaneous hydatid cyst in the abdominal wall of a 70-year-old woman: a case report" pptx
... article as: Ousadden et al.: A solitary primary subcutaneous hydatid cyst in the abdominal wall of a 70-year-old woman: a case report Journal of Medical Case Reports 2011 5:270 Submit your next manuscript ... publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Figure Image of the totally excised hydatid ... rendering the diagnosis, showing the size, localization, relationship to adjacent organs, and type of the cyst It can also be used to search for another hydatid location [1,4] The radiological findings...
- 3
- 303
- 0
Báo cáo y học: "Laparoscopic resection of a primary hydatid cyst of the adrenal gland: a case report" pot
... by a transabdominal laparoscopic approach The exploration of the rest of the peritoneal cavity did not reveal any other lesions The area around the cyst was carefully packed with gauze soaked ... normal limits The patient confirmed that she had had animal contact The albendazole preoperative therapy resulted in the disappareance of pain The diagnosis was confirmed by surgery The cyst was ... organs as the adrenal glands via the systemic circulation A hydatid cyst of the adrenal gland is extremely rare: only 15 cases have been described to date in the English language medical litera-...
- 4
- 254
- 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx
... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, the ... the usual scenario of aggressive ICU care, invasive assessments and a myriad of consultations was pre-empted for a large percentage of those patients who, traditionally, would have required them ... was the fact that many of the persons who had operated the AEDs for these survivors had never been trained how to use them [9] In essence, technology has now made the average person readily capable...
- 3
- 280
- 0
Báo cáo y học: "The establishment of a primary spine care practitioner and its benefits to health care reform in the United States" docx
... clinician who can fill the role of a primary care provider for the diagnosis and non-surgical management of SRDs; a primary care physician for the spine” Primary Care for the Spine Primary care” ... use of imaging and appropriate communication of findings may also help avoid the iatrogenic disability that can arise as a result of the medicalization of imaging findings that are of questionable ... fundamental problem lies at the heart of the “supermarket approach” to SRDs; the lack of a “general practitioner” who has advanced training in spine care, who understands the multifactorial nature of...
- 11
- 446
- 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC Trk1-Seq-F1 ACAAAGACAGCACCAACAGA Trk1-Seq-R1 GAAGTAGTGAACCGCGATAA Trk1-Seq-F2 TGGATCGTGCAATTATCTTG Trk1-Seq-R2 AAGGCGATTAAGTTGGGTAA ... potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in DNA manipulation, available ... channels and are strongly regulated by voltage They are active at the plasma membrane as inward, weakly-inward and outward channels The KCO family does not have voltage sensor domains as in Shaker family,...
- 109
- 382
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25