diagnosis of gastroesophageal reflux ultrasonographic method lucio villegas menendez m arguelles martin f coronel rodriguez c gonzalez fernandez f gonzalez prada f ann esp pediatr 1993 nov 39 5 4 4
... recognition of atypical symptoms defining GERD, particularly when these atypical symptoms occur in the absence of typical symptoms or endoscopic evidence of mucosal damage Given the diagnostic challenges ... predictor of treatment outcome following reflux therapy [58 ] Number ofReflux Events The total numbers ofreflux events on ambulatory reflux monitoring have been proposed as a means of defining ... through-thescope pneumatic dilator The goal of dilation is to provide mechanical disruption of fibrosis (Fig.2.2b) Clinical axiom suggests that achieving a luminal diameter of 141 5mm is typically sufficient...
... visit (after months of maintenance treatment) [13] The study was performed in accordance with the ethical principles of the Declaration of Helsinki, the Good Clinical Practice and the Wet Medisch-Wetenschappelijk ... visit Symptoms were scored as follows: none (no complaints), mild (aware of symptom, but easily tolerated), moderate (discomforting symptom, sufficient to cause interference with normal daily activities ... received acute treatment for their symptoms with esomeprazole 40 mg once daily for 2, or weeks The length of acute treatment was dependent on the length of time taken to achieve sufficient symptom relief...
... efficiency of commercial tomato extracts compared with prick-prick fresh tomatoes remains unknown The objective of the study was to compare the wheal sizes induced by prick tests containing freeze-dried ... [http://www.mercasa.es/nueva/revista/pdf83/tomate.pdf] Carnés J, López-Matas M, Ferrer A, Larramendi C, Huertas J, Casanovas M, Fernández-Caldas E: Immunochemical Characterization Publish with Bio Med Central ... Ferrer A, Carnés J, Gallego MT, Andreu C, Fernández-Caldas E: Characterization and improvement of apple extracts for the diagnosisof apple IgE-mediated allergy Ann Allergy Asthma Immunol 20 05, ...
... samples from 200 patients with presumptive diagnosisof brucellosis which were sent to Central Microbiology Laboratory of Selcuk University Meram Faculty of Medicine from various clinics were included ... identified Acknowledgement This study was supported by a scientific research fund of Selçuk University School of Medicine Conflict of Interest The authors have declared that no conflict of interest ... Pinedo A, Smith HL Comparison of a Dipstick Assay for Detection of Brucella-Specific Immunoglobulin M Antibodies with Other Tests for Serodiagnosis of Human Brucellosis Clinical And Diagnostic Laboratory...
... approaches for identification of serum biomarkers to detect breast cancer Clin Chem 2002 ;48 (8): 1296–13 04 27 Mathelin C Cromer A, Wendling C, Tomasetto C, Rio MC: Serum biomarkers for detection of ... JAMA 1999;281: 147 0–2 24 Smith RA, Cokkinides V, Eyre HJ American Cancer Society guidelines for the early detection of cancer, 20 04 CA Cancer J Clin 20 04; 54 :41 52 25 Chan DW, Sell S Tumor markers ... SELDI-TOF-MS to Discriminate Transitional Cell Carcinoma of the Bladder Cancer from Noncancer Patients Eur Urol 20 05; 47 (4) : 45 6 46 2 16 Wilson LL, Tran L, Morton DL, Hoon DS: Detection of differentially...
... HCV v2.0 Roche Molecular Systems Roche Molecular Systems Bayer HealthCare Manual RTPCR 50 IU/ml NA Semiautomated RT-PCR Manual TMA 50 IU/ml NA 10 IU/ml NA Roche Molecular Systems Roche Molecular ... observed according to the presence or absence of either marker The presence of HCV RNA in the absence of anti-HCV antibodies is strongly indicative of acute HCV infection, which will be confirmed by ... polymerase chain reaction, TMA : transcription-mediated amplification, bDNA : “branched DNA“, NA : not applicable *for 0.2 ml or 0 .5 ml of plasma analyzed, respectively Assay Manufacturer Amplicor®...
... different commercial and non-commercial testing methods for detection of drug resistance Sensitivity1/ Early detection Genotypic Methods Direct Sequencing RFLP RT-PCR LiPA Florescence MALDI-TOF ... among different methodologies Useful marker of infectivity in presence of precore/core promoter Relatively slower to detect drug resistance mutants Confirmation of spontaneous remission or co-infection ... standards [5] Commercial assays that make use of semiautomated systems can overcome these limitations [2 ,5] In contrast to PCR tests that measure HBV DNA titers only after completion of the PCR cycle...
... GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT GCTGCCACCCGTAGGTGT Reference Lane (1991) Lane (1991) This study This study Crocetti ... Candidatus ‘Accumulibacter phosphatis’ Most eubacteria Planctomycetales Verrucomicrobiales Sequence (5' !3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC ... PCR as shown in Table Sequence of PAO 65 1f is the reverse complement sequence of PAO 651 probe Sequence of PAO 846 r is the same sequence of PAO 846 probe For the quantitative PCR, LightCycler (Roche)...
... adjacent myometrium [ 34 38] Therefore, intravenous dynamic contrast enhancement is necessary at MRI study of endometrial carcinoma The reported diagnostic accuracy of dynamic contrast-enhanced MRI ... numbers of patients and long-term follow-up is needed to establish the accuracy of ADC measurement for uterine endometrial cancer Uterine myometrium In order of frequency, malignant tumors of ... decrease in the ADC [21, 22, 28, 49 ] The mean ADC of mature cystic teratomas was lower than of malignant ovarian cystic tumors (Figs 6, 8) [22,23] The cystic components of mature cystic teratomas...
... algorithms.29 Methods ofdiagnosis Smear microscopy for acid-fast bacteria Microscopy for the detection of acid-fast bacilli is rapid, low cost, and speci c and detects the most infectious cases of ... improve sensitivity of smear microscopy for tuberculosis: a systematic review Lancet Infect Dis 2006; 6: 6 64 74 www.thelancet.com Vol 369 June 16, 2007 Public Health 41 42 43 44 45 46 47 48 49 ... CM, Reller LB Controlled comparison of BACTEC 13A, MYCO /F LYTIC, BacT/ALERT MB, and ISOLATOR 10 systems for detection of mycobacteremia J Clin Microbiol 2003; 41 : 1987–90 Katoch VM Diagnostic...
... profile profile profile profile profile profile 3* 4* 0.7 144 0.67 15 1 0.00 34 0 .47 07 0.7 144 0.67 15 1 0.00 34 0 .47 07 0.7 144 0.67 15 1 0.00 34 0 .47 07 *significance at percent level The results of the ... 72 (4) , pp 51 9 -53 7 Colombo, S., N Hanley, J Calatrava-Requena (20 05) , “Designing Policy for Reducing the Off-farm Effects of Soil Erosion Using Choice Experiments”, Journal of Agricultural Economics, ... programme alternative, and the vector of coefficients to l are attached to the vector of interaction terms (S) that influence utility Since household characteristics are constant across choice occasions...
... primers used were 5' -TCCGCTGCCAGTCGTCTTCC-3' and 5' -GTCCTCGCGAGTCTAGGCCA-3' Forty cycles of amplification were performed using an initial denaturation step of 95 C for five minutes, followed by denaturation ... Ravetkar, former Chief Medical Officer, Pune Municipal Corporation, Dr Nagkumar K, Chief Medical Officer, Pimpri Chinchwad Municipal Corporation, Dr Dileep Jagtap, Tuberculosis Control Program Officer, ... S Comprehensive evaluation of performance, laboratory application, and clinical usefulness of two direct amplification technologies for the detection of Mycobacterium tuberculosis complex Am...
... observed Material was collected from the field over a period of 18 months commencing from September, 1963 The number of specimens collected at each centre and the proportion of positive among them are ... duplicate smear examination, for different centres, could be attributed mainly to chance fluctuations in sampling of specimens for smear preparation and intra-reading differences of NTI technician ... sputum examination at a centre, efficiency of supervision, type of corrective actions taken etc Efficiency is likely to be adversely affected by transfer of trained personnel and their replacement...