... (5¢–GCTCGCGGCCGCAGCTAGCA AACCGGAACGTTCAGG-3¢), at position 1 277 , and 3¢-EcoRI (5¢-TACGACGAATTCGGCCAGATCAAG GC-3¢), at position 1359 over the area to be substituted Construction of arabinose inducible ... References are indicated in brackets after each interacting protein name and putative interaction amino acid residues are marked in bold E-son (315–432) R18 GPIb -a (593–610) IP5-Pase(359– 371 ) NADE (81–100) ... proteins interact with all isoforms of the 14-3-3 family Finally, in vivo an ExoS protein lacking the 14-3-3 binding site is unable to ADP ribosylate cytoplasmatic proteins, e.g Ras, and is impaired...
... thaliana A comparison of the arrangements of overlapping gene pairs in Arabidopsis A comparison of the arrangements of overlapping gene pairs in Arabidopsis thaliana A and A' label the start and end ... Higgins J, Jotham J, May S: NASCArrays: a repository for microarray data generated by NASC's transcriptomics service Nucleic Acid Res 2004:D 575 -D 577 NASCA Arrays: Affymetrix ATH1 arrays database ... prediction and identification of cis-natural antisense transcripts in Arabidopsis thaliana Genome Biol 2005, 6:R30 Kiyosawa H, Yamanaka I, Osato N, Kondo S, Hayashizaki Y: Antisense transcripts with FANTOM2...
... The let -7 microRNA represses cell proliferation pathways in human cells Cancer Res 67, 77 13 77 22 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido ... Peking Union Medical College (Beijing, China) and maintained in our laboratory HEK293T (American Type Culture Collection, Manassas, VA, USA) and MCF -7 cells were maintained in 10% fetal bovine ... 5¢-GUG GAUAUUGUUGCCAUCA-3¢ The sequences of two siRNAs for ESR1 are as follows: ERa siRNA #2 sense strand 5¢-UCAUCGCAUUCC UUGCAAAdTdT-3¢, antisense strand 5¢- UUUGCAAGGAAUGCGAUGAdTdT-3¢; ERa siRNA...
... used in this study are shown in Table S1 Construction of bacterial strains Initially, an unmarked deletion was generated in nirF ina wild-type GB 17 P pantotrophus strain This was performed ina ... sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans Antonie Leeuwenhoek 66, 111–1 27 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (19 97) Gene ... accumulation and consumption in Paracoccus pantotrophus strains Starter cultures were grown aerobically in LB with shaking before inoculation of mineral salt medium containing 20 mM nitrate ina 1%...
... Ser127Ala) and a double-mutant protein (Ser16AlaSer127Ala) In this article, we report that the replacement of both invariant serine residues (Ser16AlaSer127Ala double-mutant protein) in the active ... not able to detect the intermediate This demonstrates that the Ser16AlaSer127Ala double-mutant protein, in contrast to the single-mutant proteins (Ser16Ala and Ser127Ala) is not capable of forming ... reaction is characterized by the occurrence of a transient species 1468 Table Chorismate synthase activity of the serine mutant proteins (Ser16Ala, Ser127Ala and Ser16AlaSer127Ala) in comparison...
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2 279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...
... were as follows: cycD-F, 5¢-GGGATCCCA CATTGTATTCG-3¢; cycD-R, 5¢-ACGGAGCTTTGAAG CCAGTA-3¢; cycE-F, 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; ... interbands of euchromatin and regulates chromatin organization at band–interband boundaries [52] In addition, JIL-1 histone kinase functions to maintain euchromatic regions via antagonizing heterochromatinization ... structural element in heterochromatin and acts at particular domains rather than functioning as a general modifier of chromatin In conclusion, our data suggest that dJmj plays important roles during...
... 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4-R¢¢ T4-R¢¢ was inserted ... synthetic double-stranded (ds) oligonucleotide (T4¢¢), obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic ... segment, as examined ina transient transfection assay The promoter activity was determined ina luciferase assay, with the activity of pST0 ⁄ TLN -7 used as a standard Values are shown as means ±...
... answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that' s 1031), and so through the alluring samaptalambha (10 37) and the ... 1 072 and 10 87, you have to say that Archimedes' estimate wasn't all that bad This isa spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at ... of atheism partly for pointing out that Indian texts predated Adam) Can we say that Archimedes' Sand-Reckoner and its zeroless ranks of numbers influenced a charming story in the Lalitavistara,...
... joining (NHEJ) DNA repair pathway and these data thus provide a link between the ATM kinase and NHEJ pathway We and others have presented extensive evidence indicating that NHEJ is involved in ... regulators induced by DNA damage Nat Cell Biol 2003, 5:255-260 Kobayashi J, Tauchi H, Sakamoto S, Nakamura A, Morishima K, Matsuura S, Kobayashi T, Tamai K, Tanimoto K, Komatsu K: NBS1 localizes ... crossroads of dna repair and checkpoint signalling Nat Rev Mol Cell Biol 2002, 3:3 17- 3 27 Lukas C, Falck J, Bartkova J, Bartek J, Lukas J: Distinct spatiotemporal dynamics of mammalian checkpoint...
... official EULAR journal This now has an impact factor of over and is next only to the ACR journal Arthritis and Rheumatism in its field The submission rate to the Annals is increasing substantially ... pleased to invite another Nobel laureate from amongst us He indicated that the task should not be impossible, now that vaccination had advanced to the point where even cucumbers could be vaccinated! ... clinical problem discussion and one state-of-the-art/update line of sessions Having fewer invited speakers would certainly incur some disappointment among the rank and file congress speakers, and...
... Tabata T, Tsukamoto N, Fooladi AA, Yamanaka S, Furukawa T, Ishida M, Sato D, Gu Z, Nagase H, Egawa S, et al: RNA interference targeting against S10 0A4 suppresses cell growth and motility and induces ... selective binding of nanocomplexes to ALCL cells The aptamer-mediated binding A Aptamer Polyethyleneimine (PEI) Ap t Aame r RN Aptamer Sodium citrate + si PEI-citrate me r p A Aptananocore ta siRNA mer ... CD30-expressing lymphoma cells with binding characteristics similar to a CD30-specific antibody [31] Anaplastic lymphoma kinase (ALK)-positive anaplastic large cell lymphoma (ALCL) is an aggressive...
... to amplify full-length cDNAs: ACR9, 5’-TGTTGTT GATTCATTGGCTC-3’ and 5’-AGTAGTAGATGAATATATTG-3’; ACR10, 5’-ATAGGAGGAACAACACAAAC-3’ and 5’-TTACTATGAAACCCACACAG-3’; ACR11, 5’-AAAAGGATCCATGGCTATGGCCTCT ... ACT domain repeat proteins in Arabidopsis Plant Physiol 2002, 130: 179 7-1806 41 Hayakawa T, Kudo T, Ito T, Takahashi N, Yamaya T: ACT domain repeat protein 7, ACR7, interacts with a chaperone ... genomic DNA by PCR using the primers 5’-CACCTCTAGACACTCAAAAATCGGAATTAA-3’ and 5’-AACAAAG CTTATCTCTTGAGTCTGACTCAA-3’ The PCR product was cloned into the pCR2.1-TOPO vector (TOPO TA Cloning Kit, Invitrogen)...
... species In addition, the four factors have many domains in common A GTP binding domain (Domain I) is present in all factors, while TypA, LepA and EF-G share an additional three domains (Domains II, ... present in Chlamydomonas reinhardtii, rice and Arabidopsis The products of these genes fall into two distinct clades The corresponding Arabidopsis and rice genes in each clade having extraordinarily ... using the Cereon genomics Indel and SNP databases (Figure 2A; [ 37] ; all unpublished primers used in this report are listed in Additional file 1, Table S1) We reasoned that mutations that can cause...
... point Data are reported as mean ± SD and InStat 2.01 for Macintosh software package was used for all analysis Data were analyzed using one-way analysis of variance (ANOVA) with Student Newman ... increase of MUC5AC is maintained at day 25 and not at day 31 Levels of β-Tubulin IV protein in the NHBE shown an inverse dependence on IL-13 concentration at days 22 and day 28 with levels remaining ... apoptosis and has marked mucus metaplasia It is widely accepted that the epithelium in asthmatics is biochemically abnormal due to its ability to release greater amounts of pro-inflammatory cytokines...