development of a dosing formula for carboplatin

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
  • 11
  • 873
  • 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Ngày tải lên : 14/03/2014, 13:20
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... close to the real area has to be greater than that afar Fig 21 The 3D computational domain surrounding a real 3D topography 104 D.N Hai, N.T Thang / VNU Journal of Science, Mathematics - Physics...
  • 14
  • 402
  • 0
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx

Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx

Ngày tải lên : 19/06/2014, 08:20
... a parabolic manner and was modeled as A( θ) = a( 40 - θ)2 + b(40 - θ) + A4 0, (11) where A4 0 is the value of A at 40° of knee flexion, and a and b are constants that need to be identified for each ... velocity of motor scaling factor for force at 40° of knee flexion scaling factor to account for force at each knee flexion angle scaling factor to account for force at each knee flexion angle knee ... FES are probably complex One way to assist the search for the optimal pattern is to use mathematical models that can predict forces accurately to a range of physiological conditions and stimulation...
  • 20
  • 466
  • 0
Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx

Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx

Ngày tải lên : 07/08/2014, 18:21
... Listeria spp using specific flagella antibodies 43 washing, 100 µl of each HRP conjugated MAb was added into each well and incubation for 30 at RT After adding ABTS (KPL, USA) and 30 min’s incubation ... pair for a sandwich ELISA Each monoclonal antibody (MAb) was diluted in carbonate buffer (pH 9.6) to the concentration of 10 µg/ml and 100 µg of diluted MAb was added into ELISA plate (Costar, ... et al other Listeria spp are classified to A, B, C, or D type flagella antigen; but L grayi only have the E type flagella antigen [1] According to the report by Vatanyoopaisarn et al [22], attachment...
  • 6
  • 388
  • 0
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx

Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx

Ngày tải lên : 10/08/2014, 21:24
... verruca plantaris: a case report Dermatol Online J 2006, 12 36 Virgili A, Corazza M: Guess what! Metastatic malignant melanoma of the leg from a warty acral amelanotic malignant melanoma Eur ... focus of such papers was often around misdiagnosis, delay and deterioration of the lesion Based on this data, a new acronym was proposed specific for foot melanoma An existing ABCDE acronym was ... Dawber RP, Colver GB: The spectrum of malignant melanoma of the nail apparatus Semin Dermatol 1991, 10:82-87 22 Franke W, Neumann NJ, Ruzicka T, Schulte K: Plantar malignant melanoma - a challenge...
  • 4
  • 403
  • 0
Báo cáo y học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" pps

Báo cáo y học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" pps

Ngày tải lên : 11/08/2014, 05:21
... and approved the final manuscript Additional material Additional file Candidate factors by change stages Table lists 33 candidate factors by organizational change stages that the expert panel assessed ... provides a model of change implementation in healthcare organizations, informed by the implementation of a major patient safety initiative at a large, multisite, academic hospital in Toronto, Canada ... intervention Assessment Domains Organizational Readiness Predictive of successful implementation Capacity to manage change Mean Change stage one: organizational goals & architecture Please tell us to what...
  • 8
  • 347
  • 0
báo cáo khoa học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" doc

báo cáo khoa học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" doc

Ngày tải lên : 11/08/2014, 16:20
... and approved the final manuscript Additional material Additional file Candidate factors by change stages Table lists 33 candidate factors by organizational change stages that the expert panel assessed ... provides a model of change implementation in healthcare organizations, informed by the implementation of a major patient safety initiative at a large, multisite, academic hospital in Toronto, Canada ... intervention Assessment Domains Organizational Readiness Predictive of successful implementation Capacity to manage change Mean Change stage one: organizational goals & architecture Please tell us to what...
  • 8
  • 236
  • 0
Báo cáo y học: "Development of a triage protocol for patients presenting with gastrointestinal hemorrhage: a prospective cohort study" pdf

Báo cáo y học: "Development of a triage protocol for patients presenting with gastrointestinal hemorrhage: a prospective cohort study" pdf

Ngày tải lên : 13/08/2014, 10:20
... study, acquisition of data, and data analysis and drafted the manuscript NS participated in the design of the study, acquisition of data, and data analysis for the development set KH and LC participated ... variable and for combinations of variables were calculated from standard × tables, including 95% CIs When specific variables were not measured, values were considered normal All statistical analyses ... Y, Harada K: Shock index correlates with extravasation on angiographs of gastrointestinal hemorrhage: a logistic regression analysis Cardiovasc Intervent Radiol 2007, 30:861-865 Page of (page...
  • 8
  • 283
  • 0
development of a simplified concept for process benchmarking of urban wastewater management xây dựng một phương pháp đơn giản cho benchmarking ngành quản lý nước thải đô thị

development of a simplified concept for process benchmarking of urban wastewater management xây dựng một phương pháp đơn giản cho benchmarking ngành quản lý nước thải đô thị

Ngày tải lên : 09/01/2015, 08:54
... of wastewater management system and (4) current situation of urban wastewater management in Vietnam 1.1 Characteristics of Urban Wastewater 1.1.1 What is Urban Wastewater? According to Tchobanoglous ... can be transferred internally for improvement” The advantage of internal benchmarking is often easy to define comparable processes, to get data and information and often on a standard form (Anderson ... There are two types of data: operating data changing yearly and conservative data such as design capacity, tank volume only changing in case of upgrading The former data is required to update each...
  • 115
  • 825
  • 0
Development of a robotic nanny for children and a case study of emotion recognition in human robotic interaction

Development of a robotic nanny for children and a case study of emotion recognition in human robotic interaction

Ngày tải lên : 09/09/2015, 10:18
... pre-specified tasks to assist nurses and teachers, and can be employed for animal-assisted therapy (AAT) and animal-assisted activities (AAA) instead of real animals [2] This can partly reduce ... the authors evaluated its generalization ability on another two databases: 31 MMI database and JAFFE database The accuracy rates about basic expressions and neutral expression are only 51.1% for ... methods are popular for facial expression recognition and also demonstrate reasonable performance in terms of the recognition accuracy 2.2.1 Appearance-Based Facial Expression Recognition Appearance-based...
  • 172
  • 452
  • 0
Hyperscsi  design and development of a new protocol for storage networking

Hyperscsi design and development of a new protocol for storage networking

Ngày tải lên : 16/09/2015, 15:54
... has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A UDP datagram can be encapsulated in an IP packet ... parameter to determine the total data transfer rate and packet loss ratio RBUDP separates the signaling control and data communication channel to achieve higher data transfer rate The analytical ... potential Examples of such applications are email, multimedia, distributed computing, and e-commerce As a result, the demand for storage has grown at an amazing speed The amount of data stored is at...
  • 169
  • 515
  • 0
DEVELOPMENT OF a SIMPLIFIED CONCEPT FOR PROCESS BENCHMARKING OF URBAN WASTEWATER MANAGEMENT

DEVELOPMENT OF a SIMPLIFIED CONCEPT FOR PROCESS BENCHMARKING OF URBAN WASTEWATER MANAGEMENT

Ngày tải lên : 20/06/2016, 10:25
... Maturation lagoons Maturation (tertiary) lagoons Carbonaceous BOD removal Facultative lagoons Facultative lagoons Carbonaceous BOD removal, waste stabilization Anaerobic lagoons Anaerobic lagoons ... Composition of Wastewater The analysis of wastewater data involves the determination of the flowrate and mass loading variations From the standpoint of treatment processes, average flowrates and average ... of wastewater management system and (4) current situation of urban wastewater management in Vietnam 1.1 Characteristics of Urban Wastewater 1.1.1 What is Urban Wastewater? According to Tchobanoglous...
  • 115
  • 289
  • 0
Development of a recommender system for the selection of software architecture methods

Development of a recommender system for the selection of software architecture methods

Ngày tải lên : 10/12/2016, 15:36
... thousand • usage of several thousands of applications and a huge IT-landscape • high demand on software architecture knowledge & management Florian Mittrücker - Master Thesis Background and motivation ... systems Databases • Several areas are involved: Information retrieval / Forecast theories / Marketing … • Five databases of EBSCO / Science Direct / Google Scholar Analyse steps Title & Abstract screening, ... screening, Number of citations potentially relevant (Y/N) Available (Y/N) Analysis of article content, for- / backward search  relevant (Y/N) Classification of article Source(s): (Armstrong, 2001...
  • 22
  • 274
  • 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Ngày tải lên : 28/10/2013, 11:15
... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... and biodiversity are most threatened values  Amount of commercial shipping and number of trading partners affecting pathway strength  A limited number of IMP have been identified in APEC Management...
  • 10
  • 583
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT...
  • 14
  • 473
  • 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

Ngày tải lên : 23/03/2014, 06:20
... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the gene for ... Institute of Technology, Japan) for providing guinea pig liver TGase 2, Dr T Yoshimura (Graduate School of Bioagricultural Sciences, Nagoya University, Japan) for technical advice on analysis of the...
  • 11
  • 449
  • 1
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Ngày tải lên : 30/03/2014, 20:20
... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced ... CA, USA) as a template PCR was carried out as described above using the forward primer (5¢-AATTCTGCAGTCGACGGT AC-3¢) and the reverse primer (5¢-GATTATGAATTCG AGTCGCGGCCGCTTTACTT-3¢) An EcoRI site...
  • 9
  • 380
  • 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Ngày tải lên : 31/03/2014, 08:20
... L .A. , Rivier, J.E & Vale, W.W (1999) Comparison of an agonist, urocortin, and an antagonist, astressin, as radioligands for characterization of corticotropin-releasing factor receptors J Pharmacol ... to SDS/PAGE Autoradiography was carried out on a BAS-IP NP 2040P imaging plate Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt) Gel documentation was accomplished ... difference was not statistically significant The photoactivatable antisauvagine-30 analog was shown to be as potent as its parent peptide when stimulating cAMP accumulation alone or suppressing agonist-induced...
  • 7
  • 344
  • 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Ngày tải lên : 18/06/2014, 16:20
... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed ... 10.1186/1479-5876-8-51 Cite this article as: Arai et al., Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R ... were among the "inventoried" assays available from ABI, and are described in Table cDNA synthesis, preparation of samples for TLDA assay and measurements of RNA concentration were performed as...
  • 13
  • 528
  • 0

Xem thêm