development of a broad host synthetic biology toolbox for ralstonia eutropha and its application to engineering hydrocarbon biofuel production
TEACHING FOR EXPERIENTIAL LEARNING AND ITS APPLICATION TO THE VOCATIONAL TRAINING OF CIVIL ELECTRICAL SERVICES FOR RURAL LABORERS
... electrical network installation; Repair of fans, motors and voltage regulator; Repair and maintenance of refrigerators and air conditioning Since the time factor and scope of the research, the ... jobs, the expansion of industrial areas as agricultural land area is shrunk, leading to the increase of waves of migration to urban areas looking for work The process of migration has created consequences ... learners are eager and are attracted and actively participate in learning activities; there are many opinions and arguments, among members of the group, among the groups together to address the learning...
- 28
- 278
- 0
báo cáo hóa học: " Development of a proxy-reported pulmonary outcome scale for preterm infants with bronchopulmonary dysplasia" ppt
... BR, Jobe AH, Wright LL, Fanaroff AA, Wrage LA, Poole K, National Institutes of Child Health and Human Development Neonatal Research Network: Validation of the National Institutes of Health consensus ... scale, particularly for the feeding assessment section We defined “desaturation” as an oxygen saturation of less than 80%, and we defined “increased respiratory rate” as a respiratory rate above ... the infant’s baseline respiratory Page of 11 rate was already above 60, an “increase” is defined as a respiratory rate above the baseline We provided instructions for how to calculate the baseline...
- 11
- 490
- 0
Development of a miniaturization assay platform and its application to study scarce biological samples
... microfluidic platform can only cater to a limited variety of assays; redesigning is required for it to cater to other varieties of assays and to serve as a generic platform As a result, microfluidics ... there has been a growing trend to move away from biochemical-based assays, and to apply cell-based assays for drug discovery [34] Cell-based assays characterize a range of variables such as cell ... Development of the Alpha Prototype DropArrayTM Accelerator and Plates The alpha prototype DropArrayTM Accelerator was contracted to Akribis Systems Pte Ltd for development based on our specifications...
- 108
- 288
- 0
Piloting Local Decision Making in the Development of a REDD+ Compliant Benefit Distribution System for Viet Nam
... decided to allocate half of the total benefits to cash payments in year under scenario as a way to avoid the potential repayment of benefits disbursed earlier Group changed the annual allocations for ... BDS Awareness-raising and training remains a daunting task to undertake in preparation for socially and culturally appropriate self-selection activities The significance of awareness raising and ... than just the monitoring of forest carbon Instead, PFM recognises the role of local actors in generating data for a range of REDD+ and broader collaborative sustainable forest management In particular,...
- 91
- 142
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... eubacteria Most eubacteria, archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Most eubacteria Planctomycetales Verrucomicrobiales Sequence (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG ... CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT GCTGCCACCCGTAGGTGT Reference Lane (1991) Lane (1991) This study This study Crocetti et al...
- 7
- 719
- 0
Báo cáo hóa học: " Research Article Stability of a Jensen Type Logarithmic Functional Equation on Restricted Domains and Its Asymptotic Behaviors" pdf
... and Applications, vol 276, no 2, pp 747–762, 2002 15 J M Rassias and M J Rassias, “On the Ulam stability of Jensen and Jensen type mappings on restricted domains,” Journal of Mathematical Analysis ... G Isac, and T M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and their Applications, Birkhă user, Boston, Mass, USA, 1998 ... “Multiplicative transformations,” Proceedings of the National Academy of Sciences of the United States of America, vol 36, pp 564–570, 1950 D G Bourgin, “Classes of transformations and bordering transformations,”...
- 13
- 358
- 0
Báo cáo hóa học: " Research Article A Study of Residue Correlation within Protein Sequences and Its Application to Sequence Classification" pptx
... 1990 I H Witten and E Frank, Data Mining: Practical Machine Learning Tools and Techniques, Morgan Kaufmann Series in Data Management Systems, Morgan Kaufmann, San Francisco, Calif, USA, 2nd edition, ... methods, rather than to reach a specific classification accuracy We used the Pfam -A dataset to carry out this comparison The families contained in the Pfam database vary in sequence count and sequence ... MIV examples Table shows eight examples of MIVs calculated from the Pfam database A sequence was taken from four random families, and the MIV was calculated using the literal gap method for both...
- 9
- 374
- 0
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt
... synthesize a broad family of new orthogonal transforms a priori having fast algorithms for their computation In particular, families of Haar-like, Hadamard-like, and slant-like transforms are defined based ... The fast Hadamard-like transform of order N = 11 Figure 3: The fast Haar-like transform of order N = 11 The classical Hadamard transform belongs to the family Ω of Hadamard-like transforms and ... with a fast algorithm of the same structure In particular, a family of Haar-like transforms that can all be computed with fast algorithm in structure similar to classical fast Haar transform algorithm...
- 14
- 484
- 0
Báo cáo hóa học: " Research Article A Review of Signal Subspace Speech Enhancement and Its Application to Noise Robust Speech Recognition potx
... be compared to spectral subtraction Evaluation database As test material we took the resource management (RM) database (available from LDC [34]) These data are considered as clean data, to which ... singular value of Σ The enhanced signal s(k) is recovered by averaging along the antidiagonals of Hs Dologlou and Carayannis [17], and later on Hansen and Jensen [18] proved that this overall ... straightforward way to specify the value of μ is to assign a constant value to it, independently of the speech frame at hand A more complex method is to let μ depend on the SNR of the actual frame...
- 15
- 434
- 0
Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx
... equations requires a large variety of rate equations and kinetic parameters, and unfortunately, such data are rarely available as a complete set Recently, our laboratory proposed a novel simulation ... Mathematical simulation and analysis of cellular metabolism and regulation Bioinformatics 1999, 15:749-758 Tomita M, Hashimoto K, Takahashi K, Shimizu TS, Matsuzaki Y, Miyoshi F, Saito K, Tanida ... 19:205-210 Takahashi K, Ishikawa N, Sadamoto Y, Sasamoto H, Ohta S, Shiozawa A, Miyoshi F, Naito Y, Nakayama Y, Tomita M: E-Cell 2: Multi-platform E-Cell simulation system Bioinformatics 2003,...
- 11
- 386
- 0
Báo cáo y học: "A catalog of human cDNA expression clones and its application to structural genomics" pps
... prepared for crystallization trials using biophysical methods A summary of a typical preparation for each clone, and the preparation and characterization data is given in Table Selection of clones and ... experimental data from other databases and is not determined automatically Many transcript sequences in the Ensembl database were generated automatically using cDNA sequences and exondetection algorithms ... resistance to 15 µg/ml kanamycin and carries the lacIQ repressor and the argU gene for the arginine tRNA that recognizes the rare codons AGG and AGA The low abundance of this tRNA is especially...
- 8
- 274
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2
... slab Slab thicknesses are indicated in the graph Data are calculated based on the EM theory of a 3-layers stratified system Dielectric constants of Au are evaluated using the experimental data ... thus allow for the excitation of SPPs on a smooth metal surface However, this is not straightforward since it is not possible for a radiative beam to launch a SPP on a metal v surface via a direct ... Figure A map of R and E versus d (thickness of the metal film 1) and θ o (a and b) spolarization (c and d) p-polarization ε = 2.25 (glass) ε = 1.76 (water) The dielectric constants ε1 for the Au...
- 163
- 449
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1
... Laboratory of Optical Imaging and Photodynamic Therapy in the National Cancer Centre, namely Dr Patricia Thong, Ms Ramaswamy Bhuvaneswari, Mr William Chin and Ms Lucky Sasidharan, and also to colleagues ... Schematic diagram of SNOM system for phase measurements 170 171 Fig 15 A typical AFM and SNOM mappings of a 100-nm nano-cavity substrate with cavitysurface distance of (a and b) 10 nm, and (c and d) ... method has been used to study conformational changes of a protein at a spatial resolution of about a few nm (22) Since absorption and fluorescence bands are typically broad and overlapped, they are...
- 129
- 265
- 0
DSpace at VNU: 4-tert-butoxy-1-ethoxy-1,3-bis(trimethylsilyloxy)-1,3-butadiene. A new diene and its application to the synthesis of γ-alkylidenetetronic acids
... added at −78 ◦ C The temperature of the solution was allowed to rise to 20 ◦ C over 12 h A : mixture of a saturated solution of brine and of hydrochloric acid (10 %) was added The organic layer was ... for Z A and Landesforschungsschwerpunkt ‘Neue Wirkstoffe und Screeningverfahren’) and from the Deutsche Forschungsgemeinschaft is gratefully acknowledged [14] Y Nihro, S Sogawa, A Izumi, A Sasanori, ... combined organic layers were dried ( Na2 SO4 ) and filtered, and the filtrate was concentrated in vacuo The residue was purified by column chromatography (silica gel, n-hexane-EtOAc= 20 : 1) to give...
- 5
- 111
- 0
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx
... synthesis and acetyl-CoA conversion pathway 46 acetyl-CoA fi acetoac-CoA + CoA 47 Acetoac-CoA + NADPH fi 3HB-CoA + NADP 48 3HB-CoA fi PHB + CoA 49 PHB fi 3HB 50 Acetoac + NADH fi 3HB + NAD 51 Acetoac-CoA ... b-ketothiolase Acetoacetyl-CoA reductase (NADPH) PHB synthase PHB depolymerase b-hydroxybutyrate dehydrogenase Acetoacetate-succinyl-CoA transferase D-crotonase L-crotonase Acetoacetyl-CoA reductase ... biomass production at a given total flux is obviously equivalent to maintaining a given rate of biomass production at a minimum of the total flux Insofar, the principle of maximal biomass production...
- 18
- 799
- 0
Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx
... display in a readily understandable way Software tools for handling graphs are also required Formal features of graphs can express the underlying characteristics of articles More efficient and ... Summarization by Graph Search and Matching Proe of AAAI'97, pages 622-628 Y M a a r e k and A Wecker 1994 The Librarian Assistant: Automatically Assemblin Books into Dy- 1313 namic Bookshelves Proc of ... Proc of Science, pages 843-848, Vol 267 M A Hearst, D R Karger, and J O Pederson 1995 Scatter/Gather as a Tool for Navigation of Retrieval Results Proc of AAAI Fall Symposium on AI Applications...
- 7
- 419
- 0
Báo cáo khoa học: "Generalized Encoding of Description Spaces and its Application to Typed Feature Structures" potx
... representation must be trailed For each appropriate feature, there is also a pointer to a frame for that feature's value There are also additional pointers for future features (for head, CASE) that are ... description languages of binding a variable to a feature value with a scope larger than a single TFS — for example, in sharing structure between a daughter category and a mother category in a phrase structure ... linguistic applications, we normally have a set of universal constraints anyway for encoding principles of grammar, so it is easy and computationally inexpensive to conduct this transformation Static...
- 8
- 456
- 0
Báo cáo khoa học: "Revision Learning and its Application to Part-of-Speech Tagging" pptx
... Institute of Science and Technology (in Japanese) Yuji Matsumoto, Akira Kitauchi, Tatsuo Yamashita, Yoshitaka Hirano, Hiroshi Matsuda, Kazuma Takaoka, and Masayuki Asahara 2001 Morphological Analysis ... (Matsumoto and Asahara, 2001) which is originally constructed for the Japanese morphological analyzer ChaSen (Matsumoto et al., 2001) A POS bigram model and ChaSen version 2.2.8 based on variable ... the training data for that class as a negative example, and the next ranked class is checked If the class is correct, the example is added to the training data for that class as a positive exam1...
- 8
- 499
- 0
Báo cáo khoa học: "Detection of Quotations and Inserted Clauses and its Application to Dependency Structure Analysis in Spontaneous Japanese" doc
... for Natural Language proceeding, pages 517–520 (in Japanese) Katsuya Takanashi, Takehiko Maruyama, Kiyotaka Uchimoto, and Hitoshi Isahara 2003 Identification of “Sentences” in Spontaneous Japanese ... Kawahara, and Hitoshi Isahara 2006 Dependencystructure Annotation to Corpus of Spontaneous Japanese In Proceedings of the LREC2006, pages 635-638 Kazuya Shitaoka, Kiyotaka Uchimoto, Tatsuya Kawahara, ... Maruyama, Hideki Kashioka, Tadashi Kumano, and Hideki Tanaka 2003 Rules for Automatic Clause Boundary Detection and Their Evaluation In Proceedings of the Nineth Annual Meeting of the Association...
- 7
- 386
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25