determining whether an object is an instance of a particular class
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... (patient safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of ... the data, performed the statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript ... emergency airway management procedures Success rates and complications] Anaesthesist 2004, 53:543-550 Champion HR, Sacco WJ, Copes WS, Gann DS, Gennarelli TA, Flanagan ME: A revision of the Trauma Score...
- 6
- 611
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors...
- 8
- 492
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
An autobiography of a story book pptx
... would then be able to lead a more comfortable life Perhaps I can invent cars that are operated by robots or a computer that thinks like a human My parents think highly of my ambition and are very ... understand the answer In class, I always make sure that I perform each science experiment properly When in doubt, I consult my teachers As a scientist, I would be able to invent new things for mankind ... pages and soon I was as good as new Till today I am with her giving her delight through my stories I love her very much My ambition My ambition is to become a successful scientist I have always...
- 6
- 385
- 0
An autobiography of a pen doc
... leaf of a milkweed plant After several days we hatched into tiny black and white larvae At this stage we were called tiny caterpillars We moved about the plant and fed on its fleshy green leaves ... skins and then crawled out of the old ones We then turned into large grey, yellow and orange striped caterpillars My next stage was the pupa stage I crawled under a leaf of the plant and spun a pod ... I was on display for only a short period A grand old lady came to the store one day She was looking for a gift She bought me and presented me to a girl named Mary Mary is a student and used...
- 6
- 438
- 0
An autobiography of a dancing doll ppsx
... lady came to the store She looked around the place and her eyes felon me She looked at me in admiration She at once bought me I was given as a birthday present to her only daughter Pam I was ... let her friends handle me When Pam was not attending to me, one of her friends picked me up Pam was furious and tried to pull me away form her friend In the tussle they accidentally ripped my pretty ... dress Pam cried and her mother consoled her by promising to buy a new doll I was given away to the servant’s daughter, who accepted me with great delight She skillfully mended the tear in my...
- 4
- 233
- 0
Báo cáo toán học: "An extension of a criterion for unimodality" pps
... 1994 [4] Stanley, R.: Log-concave and unimodal sequences in algebra, combinatorics and geometry Graph theory and its applications: East and West (Jinan, 1986), 500-535, Ann New York Acad Sci., ... if a j sequence is log concave then it is unimodal [5] A sufficient condition for log concavity of a polynomial is given by the location of its zeros: if all the zeros of a polynomial are real and ... difference is always nonnegative Note It would be interesting to describe the precise range of the map (a0 , a1 , · · · , am ) → (d0 , d1 , · · · , dm ) This map is linear, so the image of the set ≤ a0 ...
- 7
- 331
- 0
An Examination of the Pupil, Classroom and School Characteristics Influencing the Progress Outcomes of Young Maltese Pupils for Mathematics
... learning support assistant is similar in status to a 32 teacher assistant in England In Malta, the learning support assistant is not teacher trained Learning support assistants must follow a ... and the training of primary school teachers 1.1 Malta and the Maltese Malta and Gozo are the only two inhabited islands from the five islands that constitute the Maltese archipaelago Malta has ... Franz, Ranjita and James A past undergraduate love Colin also tragically passed away during this period Above all, I dedicate this thesis to my sons Euan and Eamonn I missed you very much and you...
- 389
- 246
- 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa
... social situation British discourse analysis was mainly influenced by M .A. K Halliday‘s functional approach to language Halliday‘s framework emphasized the social function of language and the thematic ... EFL learners are able to understand the formal structures and logical meaning of the material they read with an average degree of difficulty and within general and familiar topics, but cannot ... ―discourse analysis‖ is very ambiguous However, according to Nguyen Hoa (2000) "Discourse analysis as a study of how and for what purposes language is used in a certain context of situation and the...
- 66
- 703
- 0
Give an account of a visit to a book exhibition
... chắn bạn lớp vui mừng Cikgu Hamid nói với có hai tiếng rưỡi để duyệt sách Chúng không đánh l a xung quanh muốn mua sách đ a cho ông để ông nhận giảm giá tốt Chúng ta h a cư xử Tiếp theo rơi kệ sách ... trường cho chút thời gian để làm việc Sau thức uống giải khát quay trở lại trường để đáp ứng phần lại bạn lớp Cikgu Hamid chờ đợi Một bạn lớp xuất Sau tất lắp ráp Cikgu Hamid mua sách, khỏi hội trường ... trình duyệt phần sách đẹp minh h a động vật thực vật Ch a thấy lượng lớn thông tin liên quan đến hành tinh quý báu Trước biết nó, n a trôi qua My lòng tốt, nghĩ để qua phần lại triển lãm Vì vậy,...
- 3
- 182
- 0
What is the price of a mousetrap? The assessment of value from cloud services pptx
... The latter has the additional attributes of being available anywhere, at anytime and on any device If it was only a simple as a mouse-trap The complication is that for most customers they already ... experience across government, communications and media, and finance industries World class financial, relationship and commercial management of IT sourcing relationships Respected leader in highly-matrixed ... satisfaction A proven change agent, capable of orchestrating transformative business strategy Champions innovation with a focus on developing flexible, scalable solutions for customer and organisational...
- 3
- 507
- 0
Cutting Tool Materials What is the use of a book docx
... the plant and to amortise such costs (i.e pay-back), is the most advantageous way forward This strategy can create ‘bottlenecks’ and disrupt the harmonious flow of production at later stages within ... hardened steel parts 12 A comparison of the hardness of different popular coatings may be applicable here, as TiCN coating has a hardness of around 2,700 HV and TiAlN coating has a hardness of ... revert to its softer hexagonal form and oxidise in air This means that CBN can machine many ferrous parts and cast iron grades The complementary nature of both CBN and PCD is clearly depicted...
- 31
- 455
- 0
Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt
... 3201.0) Canberra: Commonwealth of Australia; 2005 ABS: Australian Bureau of Statistics (ABS) Life Tables, Victoria 2002–2004 (Catalogue No 3302.2.55.001) Canberra: Commonwealth of Australia; 2005 ... (ABS) Census of Population and Housing 2001, Basic Community Profile (Catalogue No 2001.0) Canberra: Commonwealth of Australia; 2002 ABS: Australian Bureau of Statistics (ABS) National Health Survey ... difficulties of obtaining a comprehensive set of weights for use in cost-value analysis List of abbreviations used 95%CI: 95% confidence interval; ABS: Australian Bureau of Statistics; AUD: Australian...
- 15
- 363
- 0
Features of a .NET Class
... dynamic_cast and safe_cast This difference means that dynamic_cast is not as slow as safe_cast, since throwing an exception is a particularly expensive and time-consuming operation const_cast ... used, and is recommended safe_cast may also be used to cast an interface pointer to an unrelated interface (a cast that static_cast cannot perform) The compiler will detect whether a cast is safe ... the AtomicNumber property to the class and its derived classes That way the radioactive atom can change the atomic number to process a decay event, but consumers of the atom class can’t otherwise...
- 38
- 298
- 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx
... Nilaparvata lugens Lucilia cuprina Anopheles dirus Bombyx mori Manduca sexta Anopheles gambiae Anopheles gambiae Blattella germanica Drosophila melanogaster Manduca sexta Anopheles gambiae Anopheles ... Udomsinprasert R, Pongjaroenkit S, Wongsantichon J, Oakley AJ, Prapanthadara L -A, Wilce MCJ & Ketterman AJ (2005) Identification, characterization and structure of a new Delta class glutathione transferase ... with a spray voltage of 4.0 kV, a sheath gas flow of 60 AU, an auxiliary gas flow of 10 AU, and a capillary temperature of 270 °C Collisioninduced dissociation was performed with normalized collision...
- 11
- 426
- 0
Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot
... Team Leader: Dr Tran Xuan Hanh Australian Organisation: Australian Personnel: Australian Animal Health Laboratory (AAHL), PMB 24, Geelong, VIC 3220, Australia Mr Chris Morrissy Date commenced: 01/03/2008 ... In Australia: Administrative Contact Name: Position: Organisation: Mr Christopher Morrissy Patents Contracts Officer AAHL, PMB 24, Geelong, VIC 3220, Australia christopher.morrissy@csiro.au In ... virus and accordingly this cell line was selected for future use The quality assured PK-1 5A cell line was transferred from AAHL to NAVETCO and a cell bank of PK-1 5A established to facilitate subsequent...
- 10
- 426
- 0
Tài liệu Which Bank Is the “Central” Bank? An Application of Markov Theory to the Canadian Large Value Transfer System doc
... interbank, money markets Bech: Federal Reserve Bank of New York (e-mail: morten.bech@ny.frb.org) Chapman: Bank of Canada (e-mail: jchapman@bankofcanada.ca) Garratt: University of California, Santa ... Bank Is the “Central” Bank? An Application of Markov Theory to the Canadian Large Value Transfer System Morten L Bech, James T E Chapman, and Rod Garratt Federal Reserve Bank of New York Staff ... quite true since the Bank of Canada is also a participant in the LVTS and acts as a drain of liquidity in Tranche Specifically, the Bank of Canada receives payments on behalf of various other systems...
- 20
- 438
- 0
Báo cáo Y học: Rum1, an inhibitor of cyclin-dependent kinase in fission yeast, is negatively regulated by mitogen-activated protein kinase-mediated phosphorylation at Ser and Thr residues pptx
... kinase (MAP3K), MAPK kinase (MAP2K), and MAPK The extracellular signals are mediated intracellularly as an activation of MAP3K that further activates MAP2K by phosphorylating specific Ser and Thr ... the pESP vector (Stratagene); sense, 5¢-GTACTTGAAATCCAGCAAGT ATATAGC-3¢; antisense, 5¢-CAAAATCGTAATATGCA GCTTGAATGGGCTTCC-3¢ The selected positive colony was grown in yeast extract plus supplements ... in part by a Grant for Pediatric Research (12C-01) from the Ministry of Health and Welfare of Japan This work was also supported by a grant from the Japan Health Sciences Foundation for Research...
- 11
- 520
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25