determine the standard form of the equation of a hyperbola with vertices

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Ngày tải lên : 07/03/2014, 05:20
... Mitsuhashi A, Yamazawa K, Nagai Y, Tanaka N, Mat- sui H & Sekiya S (2004) Correlation between MUC5AC expression and the prognosis of patients with adenocar- cinoma of the uterine cervix. Ann ... bonds. Reduction of these releases a C-terminal fragment (C2-H) that can be detected with a mAb against His 5 , and an N-terminal fragment (M-C1) that can be detected with a mAb against myc. Both the dimer and the ... by the mAbs against M1. Immunoreactivity of mAbs against M1 towards a recombinant MUC5AC C-terminal cysteine-rich part To test the reactivity of the mAbs against M1 towards the human MUC5AC C-terminal...
  • 9
  • 330
  • 0
Economic Impact of the Abolition of the Milk Quota Regime – Regional Analysis of the Milk Production in the EU – doc

Economic Impact of the Abolition of the Milk Quota Regime – Regional Analysis of the Milk Production in the EU – doc

Ngày tải lên : 18/03/2014, 00:20
... quota may take place via a variety of administrative and market-based mechanisms including private sales and quota exchanges. MS are able to determine whether transfers take place at national, ... 12,3 12,0 20,6 17,0 19,9 23,9 10,4 6,7 11,7 10,1 14,8 24,8 25,0 8,8 14,1 16,8 17,3 15,7 10,8 8,9 15,9 15,1 28,7 25,2 17,6 13,7 33,1 33,5 0,0 5,0 10,0 15,0 20,0 25,0 30,0 35,0 40,0 Belgium Bulgaria Czek Rep. Denmark Germay Estonia Ireland Greece Spain France Italy Cyprus Latvia Lithuania Luxembourg Hungary Malta Netherlands Austria Poland Portugal Romania Slovenia Slovakia Finland Sweden United ... quota rents are assumed within a range of 5-10% for all NMS apart from Bulgaria and Romania, which remain with milk production under quota, and Poland and Hungary, with quota rents above average...
  • 127
  • 569
  • 0
Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

Ngày tải lên : 23/03/2014, 17:22
... H-bond donor leads to rapid O 2 off-rates [19]. Some of the most unusual Hbs characterized to date are those from nematodes and trematodes (mammalian parasites) such as the nematode Ascaris suum (As) [11,12] ... z, away from the heme normal (z axis), a is the angle between the projection of the tilt of the z axis on the xÂ,y plane (dened direction of tilt of z and the x axis), and j % a + c denes the location ... [55] had proposed a distal Tyr at position E7 as the source of the H-bond to ligand on the basis of a partial sequence, which had indicated a Tyr on the distal E-helix. The similarity in the 1 HNMRspectraofthe three...
  • 14
  • 504
  • 0
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx

Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx

Ngày tải lên : 31/03/2014, 09:20
... between that of the monomeric and the dimeric form ( see above) in mutant PufX54*. As in these last two mutants a short lag was observed (see Table 2), apparently the presence of a stable dimer ... polypeptides span the membrane with a single hydrophobic a helix. This circular protein scaffold binds the pigments that are maintained in a spatial orientation that maximizes the efficiency of the energy ... via the plasmid pRKX (in trans) into the host Rb. s phaeroides DQ x/g, deprived of the chromosomal copy of the puf operon. Table 1. Bacterial strains and plasmids. The plasmid host strain in all the...
  • 9
  • 547
  • 0
Báo cáo khoa học: An arginyl in the N-terminus of the V1a vasopressin receptor is part of the conformational switch controlling activation by agonist docx

Báo cáo khoa học: An arginyl in the N-terminus of the V1a vasopressin receptor is part of the conformational switch controlling activation by agonist docx

Ngày tải lên : 07/03/2014, 21:20
... substitution of Arg46 on intracellular signalling The stimulation of accumulated InsPs by increasing concentrations of AVP, was assayed for each of the 19 mutant constructs and the dose–response characteristics compared ... classes of antagonist, the binding of AVP was dramatically affected by the substitution of Arg46, with the affinity of AVP for all the 19 mutant receptor constructs decreasing between 700- fold and ... UK). Mutant receptor constructs Mutation of Arg46 to each of the 19 encoded amino acids was made by a PCR approach. Mutant sense oligonucle- otides (5Â-GGGGGCCTTAGGGGACGTAXXXAATGA GGAGCTGG-3Â) contained...
  • 8
  • 487
  • 0
Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

Ngày tải lên : 16/03/2014, 23:20
... Each of these variants retains a catalytic activity against yeast RNA comparable with that of parent mBS, indicating that a native conformation is present. A further indication of the similarity ... 5Â-GAGTGCGGCC GCAAGCTTGGGCTG-3Â, had an estimated T m of 82 C. The reverse anking primer sequence, 5Â-ATATACA TATGAAAGAAAG-3Â, had a calculated T m of 42 C. The mutagenic primers for each variant are: P1 9A ... forms. However, after 48 h, a slight prevalence of the MxM form can be seen in the BS-RNase and P1 9A variant, whereas the L28Q and P1 9A/ L28Q variants still contain comparable amounts of MxM and...
  • 7
  • 404
  • 0
Báo cáo khoa học: Phosphorylation of the arginine/serine dipeptide-rich motif of the severe acute respiratory syndrome coronavirus nucleocapsid protein modulates its multimerization, translation inhibitory activity and cellular localization pptx

Báo cáo khoa học: Phosphorylation of the arginine/serine dipeptide-rich motif of the severe acute respiratory syndrome coronavirus nucleocapsid protein modulates its multimerization, translation inhibitory activity and cellular localization pptx

Ngày tải lên : 23/03/2014, 07:20
... 11507–11512. Supplementary material The following supplementary material is available online: Fig. S1. The SARS N protein is phosphorylated by SRPK1 but not by Clk1 and PKA. This material is available as part of the ... environmental stress, mRNA metabolism is reprogrammed to adapt to stress-induced damage. Translationally stalled mRNAs together with a number of translation initiation factors and RNA-binding proteins are ... mock reactions without crosslinker. The right-hand panel shows the relative abundance (percentage) of monomer and crosslinked forms. Percentage was calculated as 100 · (arbitrary unit of each form...
  • 12
  • 432
  • 0
Báo cáo khoa học: Structure of the exceptionally large nonrepetitive carbohydrate backbone of the lipopolysaccharide of Pectinatus frisingensis strain VTT E-82164 doc

Báo cáo khoa học: Structure of the exceptionally large nonrepetitive carbohydrate backbone of the lipopolysaccharide of Pectinatus frisingensis strain VTT E-82164 doc

Ngày tải lên : 23/03/2014, 18:20
... 3. Deamination of the de-O,N-acylated LPS and preparation of oligosaccharides 4 and 5 The mixture of oligosaccharides obtained after alkaline deacylation of the LPS (200 mg) was treated with 300 mg NaNO 2 in ... from other Pectinatus strains show a low molecular mass band of the same mobility as in the strain E-82164, and a ladder-like pattern, characteristic of the presence of the O-chain. No bands analogous ... 1. Deamination of the products of complete deacylation of the LPS led to the oligosaccharides 4 and 5, representing undecasaccharide and pentasaccharide fragments of oligo- saccharides 1a and/or...
  • 11
  • 326
  • 0
Báo cáo khoa học: Determination of the redox potentials and electron transfer properties of the FAD- and FMN-binding domains of the human oxidoreductase NR1 doc

Báo cáo khoa học: Determination of the redox potentials and electron transfer properties of the FAD- and FMN-binding domains of the human oxidoreductase NR1 doc

Ngày tải lên : 23/03/2014, 21:20
... potentials. Steady-state enzyme activities The catalytic activity of the NR1-FAD/NADPH domain was examined and compared with the CPR FAD/NADPH domain. The CPR FAD/NADPH domain retains trans- hydrogenase ... Results are the mean and standard deviation of triplicate assays. For the determination of apparent k cat values, experiments were performed at a saturating concentration of NADPH (200 l M ), over a ... 2A) . In the case of the NR1-FAD/NADPH domain, a second 2Â,5Â-ADP-Sepharose afnity step was also incor- porated in the purification scheme, taking advantage of its nucleotide binding capacity of...
  • 12
  • 439
  • 0
Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

Ngày tải lên : 23/03/2014, 21:20
... O-polysaccharide of Pr. alcalifaciens O23 [23], and an amide of the same amino acid with D -galacturonic acid (structure 2) in the O-polysac- charides of P. mirabilis O13 [24]. An amide of D -galacturonic acid ... gel-per- meation chromatography on Sephadex G-50. Analysis of the polysaccharide using an amino-acid analyzer revealed the presence of GlcN and GalN in the ratio 2 : 1 as well as another amino component. ... (S)-2-butyl glycosides. The D configuration of GlcA was determined by analysis of the 13 C NMR chemical-shift data of the polysaccharide (see below). The specific optical rotation values of 2S,8R-AlaLys for 2S,8S-AlaLys,...
  • 7
  • 345
  • 0
AUDIT OF THE CONTROL SYSTEM GOVERNING THE PRODUCTION, PROCESSING, DISTRIBUTION AND IMPORTS OF ORGANIC PRODUCTS potx

AUDIT OF THE CONTROL SYSTEM GOVERNING THE PRODUCTION, PROCESSING, DISTRIBUTION AND IMPORTS OF ORGANIC PRODUCTS potx

Ngày tải lên : 28/03/2014, 19:20
... countries about the content of these annual reports. TABLE 3 RESULTS OF THE COURT’S ANALYSIS OF THE CONTENT OF THE LAST ANNUAL REPORT AVAILABLE AT THE TIME OF THE AUDIT Subject Argentina Israel India New ... analysed a sample of the annual reports of third countries currently recognised as equivalent. These annual reports are not com- plete as they lack information about monitoring activities, about ... composed of a table with the number of visits carried out by the various private inspection bodies, the number of samples taken for analysis and the number of irregularities found and penalties applied....
  • 74
  • 396
  • 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Ngày tải lên : 30/03/2014, 10:20
... (d) 5Â-ATAGTTTA GCGGCC GCTTAGTGATGGTGATGGTGATGGGGCTTGCGCT GGATGAGCAGG-3Â for c1219HIS. For the e1219 variants (e1220 with additional Pro), the forward pri- mer 5Â-GGTGTA GAATTCAAGAACGAGGAACTGCG-3Â was ... 5Â-ATAGTTTA GCGGCCGCTCAATGGTGATGG TGATGGTGCTTGCGGCGGATGATGAG-3Â. For the c1218 variants (some with an additional C-terminal Pro giving c1219), the forward primer 5Â-GGTGTA GA ATTCCGGAACCAGGAGGAG ... solution of the structure of the mammalian AChR molecule. A prerequisite for this is the availability of large amounts of native, sol- uble AChR molecules, a target that can be partially achieved...
  • 12
  • 394
  • 0
Review of the Literature Regarding Critical Information Needs of the American Public

Review of the Literature Regarding Critical Information Needs of the American Public

Ngày tải lên : 02/06/2014, 09:39
... that the traditional methodological approaches, and their traditional points of focus, lack relevance today. However, the complexity of the changes taking place and the shifting nature of the ... basic premise that the increased complexity of local media ecosystems warrants the consideration of the full range of available analytical approaches to understanding how these ecosystems are ... personal networks. An adequate model of local community information needs in health must account for these various levels, and whether, and how, local health information is actually made available....
  • 124
  • 377
  • 0
protest of the ukrainian republic to the united states against the delivery of eastern galicia to polish domination. washington d. c., 1919

protest of the ukrainian republic to the united states against the delivery of eastern galicia to polish domination. washington d. c., 1919

Ngày tải lên : 04/06/2014, 17:32
... the province in exchange for the support of the Poles in the Austrian parliament. with a Polish army organized in America, of un- Amer- icanized Polish immigrants, began an offensive against the Ukrainians, attacking them from the rear. ... a temporary overthrow by the German military force was reestablished. In the latter part of 1918, the Ukrainians of Eastern Ga- licia (also predominantly Ukrainian and anciently, According to the International Encyclopedia, the entire Austrian province of Galicia (western and east- ern) ... Ukrainians. According to the Encyclopedia Brittanica, the former predominate in the West and in the big towns, and the latter in the East. According to official statistics of the Austrian pro- vincial government of Galicia, prepared and published by leaders of Polish political...
  • 28
  • 400
  • 0
Báo cáo sinh học: " Viroporin potential of the lentivirus lytic peptide (LLP) domains of the HIV-1 gp41 protein" docx

Báo cáo sinh học: " Viroporin potential of the lentivirus lytic peptide (LLP) domains of the HIV-1 gp41 protein" docx

Ngày tải lên : 18/06/2014, 18:20
... LLP domains may be flip-flopping between a transmembrane state and parallel association with the inner leaflet of the lipid bilayer. On the other hand, the LLP domains may possess different activities ... membranes. Additionally, it is the first example of a direct comparison of structure and function of an entire LLP-1 domain from the laboratory adapted HXB2 strain of HIV-1 (i.e., LLP-1) with a natural ... characterization of two active forms, and partial cDNA sequence of a precursor. Proc Natl Acad Sci USA 1987, 84:5449-5453. 3. Zasloff M, Martin B, Chen HC: Antimicrobial activity of syn- thetic...
  • 14
  • 365
  • 0

Xem thêm