designing a research study

A research study into consumers’

A research study into consumers’

Ngày tải lên : 08/04/2014, 16:55
... A name given to a food, or a reference to a place could imply that the food comes from, or has been made in, that particular area. For example a jar of ‘Texas barbeque sauce’ that was made ... Guideline daily amounts are a guide to how much energy and key nutrients the average healthy person needs in order to have a balanced diet. GDAs on labels are a guide, not a target. They are based ... investigate consumers’ understanding, knowledge and attitudes to food labelling. Two studies were carried out – a quantitative study followed by a qualitative study. Quantitative study A face-to-face...
  • 25
  • 221
  • 0
Digital Sound Recorder: A case study on designing embedded systems using the UML notation.

Digital Sound Recorder: A case study on designing embedded systems using the UML notation.

Ngày tải lên : 24/10/2013, 23:15
... ) getAlarm( ) getAlarmState( ) setAlarmState( ) Now AlarmTime Date get( ) set( ) nextDay( ) cycleDay( ) cycleMonth( ) cycleYear( ) Today Figure 3.9: Alarm clock class diagram The Alarm Clock Class ... some activity. Usually a wrapper has few attributes, because the state of the wrapper is the state of the hardware device. The detailed design and implementation of a hardware wrapper requires a ... filling rectangular regions with a flat colour. Each Graphic Context represents a rectangular area of a Display. The Graphic Context manages the geometry transformation from its local coordinate system...
  • 37
  • 589
  • 0
Tài liệu MCSE Study Guide - Designing a Network Infrastructure with Windows 2000 Exam 70-221 ppt

Tài liệu MCSE Study Guide - Designing a Network Infrastructure with Windows 2000 Exam 70-221 ppt

Ngày tải lên : 21/12/2013, 04:19
... create the DNS namespace design. Move the appropriate DNS namespaces to the appropriate company domains (Use only namespaces that apply. Use namespaces only once.) A: Corp NAmerica LAmerica corp.hansonrothers.com ... have access to the Internet. Each regional headquarters will contain a domain controller that is configured as a replication bridgehead server. Each Regional administrator team will manage all ... each location, you need to investigate the connectivity options available in that area. • Assess net available bandwidth and latency issues. Bandwidth is the measure of the amount of data that...
  • 60
  • 451
  • 0
Tài liệu The Value of the Case Study as a Research Strategy doc

Tài liệu The Value of the Case Study as a Research Strategy doc

Ngày tải lên : 20/02/2014, 11:20
... (b) Qualitative research as preparation - As mentioned above, qualitative research has a long standing history as an exploratory strategy. Comments of researchers that qualitative research is ... Yin are especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases. Reliability is most important during the data collection phase, and ... overcome at least part of the reproach directed against the case study. 3.0 Justification for case study as a research strategy This essay has thus far presented the case study as an alternate...
  • 15
  • 587
  • 0
Improving Medical Decisions Through Comparative Effectiveness Research: Cancer as a Case Study pot

Improving Medical Decisions Through Comparative Effectiveness Research: Cancer as a Case Study pot

Ngày tải lên : 15/03/2014, 00:20
... prospective databases that allow for collection and analysis of clinical and disease biomarker data that will ultimately be used for clinical trial-matching and potentially as a clinical decision-making ... these patients for molecular analysis, and collecting patients’ clinical data for use not only in treatment but also in research. 48 Administrative databases such as insurance claims databases, ... isolated public and private databases has the potential to generate an unprecedented amount of information for a variety of research activities. Given the variety of available data sources and...
  • 31
  • 317
  • 0
Cross-Channel Commerce: A Consumer Research Study pot

Cross-Channel Commerce: A Consumer Research Study pot

Ngày tải lên : 23/03/2014, 10:20
... Intel and Intel Xeon are trademarks or registered trademarks of Intel Corporation. All SPARC trademarks are used under license and are trademarks or registered trademarks of SPARC International, ... make their purchases. Some retailers are scaling back the size of the catalogs, or are publishing subcatalogs targeted at particular segments and merchandise categories. This can ease the costs ... Oracle and/or its affiliates. Other names may be trademarks of their respective owners. AMD, Opteron, the AMD logo, and the AMD Opteron logo are trademarks or registered trademarks of Advanced...
  • 17
  • 260
  • 0
TITLE: RESEARCH ON FACTORS INFLUENCING CUSTOMER SATISFACTION – A CASE STUDY OF DANAPHA PHARMACEUTICAL COMPANY, VIETNAM

TITLE: RESEARCH ON FACTORS INFLUENCING CUSTOMER SATISFACTION – A CASE STUDY OF DANAPHA PHARMACEUTICAL COMPANY, VIETNAM

Ngày tải lên : 18/04/2014, 16:24
... nationwide, each branch take care a lot of agencies and pharmacies in many provinces around it.  Beside Vietnam market, Danapha also developed abroad market such as Russia, Ukraine, Cambodia, Laos… Research ... Journal of Retailing and Consumer Services 8, 227- 236  Parasuraman, A. , & Grewal, Dhrur (2000). The impact of technology on the quality-value-loyalty chain: a research agenda. The Journal ... methodology Research purpose  To identify the key factors which influence customer satisfaction in pharmaceutical service -a case study at Danapha pharmaceutical company.  This study also provide...
  • 29
  • 962
  • 1
Research on factors affecting the student’s  satisfaction: a case study at the Da Nang University  of economics, in Vietnam.

Research on factors affecting the student’s satisfaction: a case study at the Da Nang University of economics, in Vietnam.

Ngày tải lên : 18/04/2014, 16:25
... Education 7. Parasuraman, A. , Berry, L.L. & Zeithaml, V .A. (1991). Refinement and reassessment of the SERVQUAL scale. Journal of Retailing. 8. Parasuraman, A. , Zeithaml, V. A. , & Berry, ... with many blanks, not have unification in answer trend… will be extracted. Valid questionaires will be coded and input data to SPSS software. q Data analysis The data analysis for this study ... expectation. § Many researches on students satisfaction that concerned with quality of courses and teaching (Mavondo, & Zaman, 2000, & Sapri, et al, 2009). RESEARCH METHODS Tangibles...
  • 24
  • 784
  • 2
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Ngày tải lên : 18/06/2014, 18:20
... Sequence ORF located in 8~26 ACCTCTGCCTAATCATCTC X/preC 40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC 591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein 993~1018 GGGTCACCATATTCTTGGGAACAAGA Terminal Protein 1450~1469 ... CCTGCTGGTGGCTCCAGTTC pre-S2 1571~1592 TCCTAGGACCCCTGCTCGTGTT S 1657~1679 ACTTCTCTCAATTTTCTAGGGGG S 2131~2159 TATATGGATGATGTGGTATTGGGGGCCAA S 2491~2516 TTCTCGCCAACTTACAAGGCCTTTCT RT 3199~3221 CACCAGCACCATGCAACTTTTT ... represent: FA3-L and FA3-R (amplicon size: 1059 bp), FA1-L/FA1-L' and FA1-R (amplicon size: 1014 bp), FA4-L/FA4-L' and FA4-R (amplicon size: 1072 bp), FA2-L and FA2-R (amplicon size:...
  • 7
  • 404
  • 0