design a vending machine for blind and deaf

báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf

Ngày tải lên : 19/06/2014, 08:20

9
454
0

Tài liệu Báo cáo khoa học: A facile method for expression and puriﬁcation of the Alzheimer’s disease-associated amyloid b-peptide pdf

Ngày tải lên : 18/02/2014, 13:20

... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... enzyme, and contained Aba, Abb and Abcat 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP. The product was separated from ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared in the buffer supplied with...

16
691
0

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20

... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-ampliﬁed from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde;...

11
873
0

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Ngày tải lên : 18/02/2014, 22:20

... Northeastern Area State and Private Forestry, for desktop publishing; and Victoria Evans, Group Leader – Creative Services, Northeastern Area State and Private Forestry, for her oversight and ... based market reports, trade magazines, and trade associations. Developing a relationship with an academic institution that has a wood science program that provides some market information can ... case of small wholesalers and manufacturers, frequently pricing is more of an art than a science. Manufacturing or purchase costs, overhead, general, administrative and selling costs, and a...

92
2.2K
0

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Ngày tải lên : 19/02/2014, 19:20

... International Language Resources and Evaluation (LREC’10), Val- letta, Malta. Sittichai Jiampojamarn, Kenneth Dwyer, Shane Bergsma, Aditya Bhargava, Qing Dou, Mi-Young Kim, and Grzegorz Kondrak. ... uses Hidden Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Au- tomata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... system learns this as a non-transliteration but it is wrongly annotated as a transliteration in the gold standard. Arabic nouns have an article “al” attached to them which is translated in English as...

9
521
0

Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

Ngày tải lên : 22/02/2014, 03:20

... participants found TransAhead suggestions satisfying, accepted, and learned from them; c) interactivity made translation and language learning more fun and the participants found TransAhead ... Ortiz-Martinez, L. A. Leiva, V. Alabau, I. Garcia-Varea, and F. Casacuberta. 2011. An interactive machine translation system with online learning. In Proceedings of ACL System Demonstrations, pages ... on language learning. Specifically, our goal is to build a human-computer collaborative writing assistant: helping the language learner with in- text grammar and translation and at the same...

4
393
0

Tài liệu A Science Roadmap for Food and Agriculture pdf

Ngày tải lên : 22/02/2014, 05:20

... economic data are needed to provide more accurate estimates of climate change impacts, the potential costs and benets of adaptation, and to validate and calibrate models. • Quantify costs and ... be: 28 p A Science Roadmap for Food and Agriculture 2 p A Science Roadmap for Food and Agriculture 16 p A Science Roadmap for Food and Agriculture Grand Challenge 1 hollowing-out will continue, and ... water quality impacts from animal waste. • Water institutions and policy. Develop river basin-scale institutional and planning approaches that integrate land use, water, and environmental...

104
415
0

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

Ngày tải lên : 22/02/2014, 10:20

... representation language from the application program and systematically translating it into a natural language using syntactic/semantic rules which were primarily designed for translating in the ... representation of linguistic knowledge for both analysis and generation. We argue that the only part of the average NL system's knowledge that we can have any faith in is its vocabulary and, ... (1) must include at least as much information as we have given above. In particular, the logical structure of our para- phrases contains essential information (about, for instance, the differences...

4
501
0

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Ngày tải lên : 06/03/2014, 01:20

... state and local governments, professional organizations, health-care organizations, and educational institutions) to develop hepatitis B and hepatitis C educational programs for health-care and ... anti-HCV Hepatitis C antibody API Asian and Pacific Islander AST Aspartate transaminase AVHPC Adult viral hepatitis prevention coordinators CDC Centers for Disease Control and Prevention ... kindergarten in 2006–2007), but there is variability in coverage among states. Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API),...

191
457
0

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Ngày tải lên : 06/03/2014, 01:20

... Veterans Affairs, and the National Viral Hepatitis Roundtable. Copyright © National Academy of Sciences. All rights reserved. Hepatitis and Liver Cancer: A National Strategy for Prevention and ... Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Car- ing Ambassadors Program; Joan Block, Hepatitis B Foundation; Gary ... services (for example, testing of household and sexual contacts and referral to medical care). However, most programs are understaffed and underfunded and cannot offer adequate case-management...

253
369
0

Hate on the Internet: A Response Guide for Educators and Families pptx

Ngày tải lên : 06/03/2014, 21:20

... Web sites that include hate propaganda from the National Alliance and David Duke. “If you are a teacher or student, I hope you will take a stand for right and wrong and use this information to enlighten ... demonstrate and model practical application of a critical thinking approach to assessing content and accuracy. Encourage questions about material children do not understand. Be aware of the online activities ... Internet: AResponse Guide for Educators and Families is designed to assist educators and adult family members in preparing children of all ages for safe use of the Internet. As Americans have expanded...

63
1.4K
0

Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Ngày tải lên : 07/03/2014, 00:20

... incu- bated for 22 h at 30 °C in the presence of various oxidative folding catalysts (reactiva- tion assay). The catalytic activity of (A) SsM- TAPII and SsMTAPIIC259S ⁄ C261S and (B) PfPNP and ... motif for stability and folding Giovanna Cacciapuoti, Iolanda Peluso, Francesca Fuccio and Marina Porcelli Department of Biochemistry and Biophysics ‘F. Cedrangolo’, Second University of Naples, ... CXC-peptide, and sRNaseA (0.5 mgÆmL )1 in 10 mm acetic acid; ﬁnal concentration 19.6 lm). cCMP at a ﬁnal concentration of 4mm was then added and A 296 , as a result of RNase-cata- lyzed cCMP...

7
496
0

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20

... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1 ⁄ VPS4 impairs membrane trafﬁcking out of endosomal ... D, Uchimura S, Nara A, Yoshimori T, Hayashizaki Y, Kawai J, Ishidoh K et al. (2004) Mammalian class E Vps proteins, SBP1 and mVps2 ⁄ CHMP 2A, interact with and regulate the function of an AAA-ATPase SKD1 ... oligo- merization domain (i.e. b sheets 7 and 8, the AAA domain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA...

23
490
0

Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx

Ngày tải lên : 16/03/2014, 14:20

... exam, appropriate laboratory and imaging studies, and when indicated screen patients for allergy • Prescribe appropriate medication regimens for acute and chronic sinusitis • Know of the relationships ... mucosa and sinus mucosa are similar and are contiguous 47 0031003 Rhinoscopy Aids in Diagnosing • Nasal polyps • Septal deviation • Concha bullosa • Eustachian tube dysfunction • Causes of hoarseness • ... and composition, – normal mucociliary flow to prevent mucous stasis and subsequent infection; – and open sinus ostia to allow adequate drainage and aeration. • Senior BA, Kennedy DW. Management of sinusitis...

81
534
0

Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc

Ngày tải lên : 22/03/2014, 13:20

... LES waves was associated with age and the presence of endocrine, nutritional and metabolic diseases at baseline. Increasing age was also associated with a higher likelihood of loss, as well as ... self-determination, social and cultural activity and social status (Mollenkopf & Walker 2007). Additionally, the economic status can also decrease by the supplemental costs for illness and care. ... well as increased needs for social, medical and health care (Akker et al. 1998). We analysed multimorbidity as cumulative occurrence of heart diseases, cerebral vascular diseases, diseases...