design a turing machine that performs multiplication of two numbers
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... EcoRIAAAGAATTCTTACAGGTGAGGTCAGAAGCTGATThTF6 AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA BamHI ⁄ EcoRIAAAGAATTCTTAACCTGAAAGCGCCTGTGTAGhTF7 AAAGGATCCCCCAACAACAAAGAGGGATACT BamHI ⁄ EcoRIAAAGAATTCTTAGGTGCTGCTGTTGACGTAATAThTF8 ... EcoRIhTF5CcAAAGAATTCTTACTTGCCCGCTATGTAGACAAA BamHI ⁄ EcoRIhTF5DcAAAGAATTCTTAATCCTCACAATTATCGCTCTTATT BamHI ⁄ EcoRIhTF5EcAAAGAATTCTTACCCTACACTGTTAACACT BamHI ⁄ EcoRIhTF5FcAAAGAATTCTTAAACACTCCACTCATCACA ... EcoRIAAAGAATTCTTAGGTGCTGCTGTTGACGTAATAThTF8 AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA BamHI ⁄ EcoRIAAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTThTF 5A cAAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC BamHI ⁄ EcoRIhTF5BcAAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT BamHI...
- 10
- 308
- 0
Tài liệu PRINCIPLES OF ASYNCHRONOUS CIRCUIT DESIGN – A Systems Perspective pdf
... a clock means that, in many circumstances, signals are required to be valid allthe time, that every signal transition has a meaning and, consequently, that hazards and races must be avoided.Intuitively ... in a substantial improvement in one or more of the above areas. Other obstacles are a lack of CAD tools and strategies and a lack of tools for testing and test vector generation.Research in asynchronous ... circuits designed and fabricated today are “synchronous”. Inessence, they are based on two fundamental assumptions that greatly simplifytheir design: (1) all signals are binary, and (2) all components...
- 354
- 650
- 1
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... demonstrated that Asp129 of NirFcould not be essential for any function similar to that in Asp141 of Met8P.The idea of NirF being a dehydrogenase is appealingbecause of the presence of a putative ... understood. Anal-ysis of insertional mutagenesis and complementationwork in Pseudomonas aeruginosa, Pseudomonas fluores-cens, Paracoccus denitrificans and Pseudomonas stutzerihave shown that a set of ... sequences, notably for two strains of Ps. aeruginosa, PA7 and PAO1, but also that inMagnetospirillum magneticum, do not have any readilyrecognizable, i.e. N-terminal positive charges, centralhydrophobic...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... because of the absence of the catalyticsubunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutantstrain when the mitochondrial membranes were ana-lyzed ... coxidase complex was clearly demonstrated [10–12], butalso in other organisms, such as Neurospora crassa[13], mammals [11] and plants [14]. A higher-orderorganization of the respiratory chain ... specificchaperone proteins is also required. The available dataindicate that the accessory factor Bcs1p is involved inthe binding of ISP to an immature bc1intermediate[28,29] and that Cbp3p and...
- 15
- 639
- 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
... and 127 of the Neurospora crassachorismate synthase with alanine, producing two single-mutant proteins(Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16Ala-Ser127Ala). The residual ... Ser127Ala and Ser16AlaSer127Alamutant proteins, respectively. These results demon-strated that none of the amino acid replacementssignificantly affected the utilization of NADPH as a source of ... alignments of chorismate synthas-es from bacterial, fungal, plant and protozoan origin, of the crystal structure of the enzyme with boundEPSP and of the flavin cofactor, revealed two invariantserine...
- 10
- 398
- 0
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... GGA TCCATG GAA TCG ATG TAT AAA CGG TTT TCA GTTGAA GT-3Â,andtheEcoRI restriction fragment of thechloroplast genome R14 [16] as a template. The resultingDNA fragment was then digested by ClaIandNcoI (two restriction ... 594–604.42. Hagio, M., Sakurai, I., Sato, S., Kato, T., Tabata, S. & Wada, H.(2002) Phosphatidylglycerol is essential for the development of thylakoid membranes in Arabidopsis thaliana. Plant Cell ... by capillarygas-liquid chromatography using a 50 m long, 0.25 mmdiameter CP-wax 52 column. Heptanoic acid was used asan internal standard.ResultsThe absence of functional PSII and lack of...
- 10
- 411
- 0
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): a serine protease that links tissue injury to activation of hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S,Sakiyama O, Takahashi K et al. (1989) Molecularcloning and sequence analysis of cDNA for humanhepatocyte growth factor. ... Shimomura T, Miyazawa K, Komiyama Y, HiraokaH, Naka D, Morimoto Y & Kitamura N (1995)Activation of hepatocyte growth factor by two homologous proteases, blood-coagulation factor XIIaand hepatocyte ... S& Daikuhara Y (1988) Purification and partial charac-terization of hepatocyte growth factor from plasma of a patient with fulminant hepatic failure. J Clin Invest 81,414–419.4 Miyazawa...
- 7
- 502
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... Masayo Hosono1,*, Miyako Kitamura1, Tatsuya Tsuda2, KiyofumiYamanishi2, Masatoshi Maki1and Kiyotaka Hitomi11 Department of Applied Molecular Biosciences, Graduate School of Bioagricultural ... – 2A – 1A QN+ 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Relative value00.20.40.60.811.21.4Fig. 4. Assessment of the contribution of each amino acid residue of K5 to substrate recognition. Alanine ... Bioagricultural Sciences, Nagoya University, Japan2 Department of Dermatology, Hyogo College of Medicine, Nishinomiya, JapanTransglutaminase (TGase; EC 2.3.2.13) is a Ca2+-dependent enzyme that catalyzes...
- 11
- 449
- 1
Báo cáo khoa học: A sucrose binding protein homologue from soybean exhibits GTP-binding activity that functions independently of sucrose transport activity pptx
... the characterization of a member of the SBP family from soybean [Glycine max (L) Merrill]designated S64 or SBP2. Subcellular fractionation and pre-cipitation by GTP-agarose demonstrated that S64/SBP2 ... Enhanced accumulation of SBPcaused an increase in intracellular sucrose synthase activitywith a concomitant decline in cell-wall invertase activity.This alteration in sucrose-cleaving activities ... the identification of an isoform of soybean SBP,designated S64 or SBP2, and we show that the SBPhomologue is a membrane-associated GTP binding protein.We have generated mutants that blocked...
- 11
- 343
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... Escherichia; Hafnia alvei;diarrhea; neuraminic acid.Hafnia alvei is a Gram negative bacterium and a member of the family Enterobacteriaceae. There are reports of associ-ation of H. alvei with diarrhoea ... and it was therefore concluded that the samepolysaccharide was present. A hydrolysate of the upperphase, analyzed as alditol acetates, revealed asD-glucose,D-galactose,D-galactosamine,L-glycero-D-manno-heptose,andD-glucosamine ... of a prototypaldiarrheagenic strain of Hafnia alvei that has characteristics of a newspecies under the genusEscherichiaReine Eserstam1, Thushari P. Rajaguru1,2, Per-Erik Jansson1, Andrej...
- 7
- 463
- 0
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt
... quinquestriatus hebraeus was collectedfrom scorpion stings to a parafilm membrane. Sarcophagafalculata (blowfly) larvae and Periplaneta americana (cock-roaches) were bred in the laboratory. Albino laboratoryICR ... binding to rat brainsynaptosomes [23]. As AahIT4 shares little sequencesimilarity with any of the known anti-mammalian scorpiontoxins [1,12], and no information was available on its mode of action, ... various insect and mammalian sodiumchannels [1,2,21,22]. As b-toxins that affect mammaliansodium channels have not been identified in the ÔOld WorldÕ,it was assumed that diversification of anti-mammalianb-toxins...
- 8
- 391
- 0
High speed digital system design a handbook of interconnect theory and design practices john wiley
... proportional to the rate of change, mutual inductance becomes very significant in high-speed digital applications. Mutual capacitance is the other mechanism that causes crosstalk. Mutual capacitance ... times larger than the series resistance of the conductor. 3.1. MUTUAL INDUCTANCE AND MUTUAL CAPACITANCE Mutual inductance is one of the two mechanisms that cause crosstalk. Mutual inductance ... vector network analyzer (VNA). In the frequency domain, the ac resistance is often characterized by the attenuation factor, α, which is a measure of signal amplitude loss as a function of frequency...
- 327
- 702
- 0
urban design - a typology of procedures and products
... cemetery of San Cataldo, Modena, Italy 135CASE STUDY: Kresge College, University of California at Santa Cruz, California, USA 138CASE STUDY: Ghirardelli Square, San Francisco, USA 140Urban objects ... primary dimension of any categorization. A further distinction can be made amongst urban design projects based on thevocabulary of patterns that forms the basis of their design. The vocabulary, ... in Ahmedabad. The individuals who have assisted me include El-Hassan Amr,Oleksandra Babych, Clare Billingham, Kevin Brake, Giancarlo Cerutti diLudovico, Nick Chapin, Carol Chan, Tao Cheehai,...
- 448
- 2,796
- 0
báo cáo hóa học: "Single-trial classification of NIRS signals during emotional induction tasks: towards a corporeal machine interface" pptx
... series of questions. An average offline classification accuracy of 80% was achieved in 40% of the locked-in participantsusing a non-linear discriminant classifier.The ultimate goal of a corporeal ... a baseline state can be detected. Using theoptimal feature set for each participant, mean classifica-tion rates were calculated via 10 runs of 5-fold cross-vali-dation, over a range of analysis ... optimalclassification accuracy was achieved for 8 of the 10 partic-ipants with an LDA-trained classifier, which is advanta-geous for its computational speed and ease of implementation.Quantifying...
- 14
- 320
- 0
báo cáo hóa học:" Mid-term results and factors affecting outcome of a metal-backed unicompartmental knee design: a case series" pptx
... thedescriptive analysis, obesity had a high hazard ratio of Table 2: Clinical and radiographic characteristics before and after UKAVariables Pre-operative [SD] Final follow-up [SD] P value a Knee Society ... was per-formed using antero-posterior, lateral, and Merchant viewradiographs of the knees (Figure 1B), with measurement of femoral and tibial angles, alpha and beta angles, andmedial and lateral ... lateral joint spaces as described by Villers andCartier [7]. Patients were additionally evaluated for thepresence of patellar osteophytes as an indicator of patel-lofemoral arthritis that is easily...
- 7
- 272
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25