descargar with a little help from my friends the beatles mp3
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
Ngày tải lên :
20/02/2014, 02:21
... proteases of
the coagulation system including thrombin (factor
IIa) and factors IXa, Xa, XIa and XIIa. The princi-
pal targets of the serpin are usually regarded as being
thrombin and factor Xa, although ... immediate and medium term future.
Acknowledgements
This work was supported by the National Health &
Medical Research Council of Australia, the Austra-
lian Research Council, the National Heart ... thrombin anion-binding
exosite-1 is a primary part of the allosteric activation
mechanism.
For many years, the physiological activator of HC-II
has been assumed to be extravascular dermatan sulfate
[56–64],...
- 10
- 668
- 0
With a Little Help pptx
Ngày tải lên :
06/03/2014, 14:20
... lit by candles and
draped with gathered curtains that turned the walls into the proscenia of
a grand and ancient stage. There were four or five small tables and a
long one at the back of the room, ... the neat stitching that ran the bind-
ing and the spine, holding together the nylon and the denim, taken from
a pair of jeans, a backpack. The end-papers were yellowed page three
girls from the ... he'd joined the Order, and
she wasn't there anymore. Her numbers all rang dead.
The apartment building had once been a pleasant, middle-class sort of
place, with a red awning and a niche...
- 282
- 494
- 0
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
Ngày tải lên :
13/02/2014, 06:20
... the NN – they had another better help before the
NN contacted them.
The NN took the primary contact to the female
patients and offered help in the early part of a cancer
trajectory. The NN was ... what kind of add-
itional help the patients should have. Navigators in
cancer care have been proposed to embrace this extra
help. They help the cancer patient “not only travel
the healthcare maze ... I have heard
nothing. I find that scary. (At discharge)
Doctors . come and go as they see fit . they come
and say their bit and then they leave again (ye s)
they can go as far as to turn their...
- 11
- 695
- 0
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf
Ngày tải lên :
17/02/2014, 02:20
... PALMER AT THE AGE OF 75.
CHAPTER V.
[Pg 45]
APPRECIATIONS OF RALPH ALLEN, JOHN PALMER, AND SIR FRANCIS
FREELING, MAIL AND COACH ADMINISTRATORS.
On the 25th April, 1901, the day after a ... Street.
The Gloucester and Aberystwith mail-coach continued to run until the year 1854, and
it is believed that was the last regular main road mail-coach which was kept on the
road. Its guard from ... lamented far beyond the circle of her own
family, extensive as it is. The amiableness of her manner and the rational
giving such an accommodation to the city of Bath as he always hoped that plan...
- 158
- 673
- 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
Ngày tải lên :
21/02/2014, 15:20
... oxidase from Paracoccus
denitrificans. Nature 376, 660–669.
8. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T.,
Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. &
Yoshikawa, ... sealed with another CaF
2
plate, and placed into
a metallic sample holder. The following cuvette handling
was carried out in the aerobic atmosphere. The absorbance
spectra of the mixture before and ... proton-translocating channels, called the K- and
D-channels. The D-channel contains an array of charged or
polar amino acids, and is located within two different
hydrogen-bonded networks above and...
- 8
- 474
- 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
Ngày tải lên :
07/03/2014, 00:20
... 489–495.
4 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masu-
da S, Matsunaga N & Okada H (1981) Purification and
characterization of 6-aminohexanoic acid oligomer
hydrolase of Flavobacterium sp. ... S
& Higuchi Y (2005) Crystallization and x-ray diffrac-
tion analysis of 6-aminohexanoate-dimer hydrolase
from Arthrobacter sp. KI72. Acta Crystallogr
F61,
928–930.
15 Hatanaka HS, Fujiyama ... potentially possesses an advantage for biotechnological applications.
X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme and
the inactive S11 2A- mutant–Ald complex revealed that Ald...
- 10
- 625
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
Ngày tải lên :
07/03/2014, 02:20
... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG
3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG
4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG
GGAT
1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC
2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG
3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG
3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA
Reverse GCTA
GGATCCCTAGCAACCACGGCAC
Table 2. Antifungal activity of WAMP- 1a. IC
50
is the concentration
necessary for 50% growth inhibition.
Fungi ... Escherichia coli and assays of recombinant WAMP-
1a activity against diverse plant pathogens, such as
chitin-containing and chitin-free fungi, and Gram-
positive and Gram-negative bacteria. The amino acid
sequence...
- 10
- 505
- 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
Ngày tải lên :
07/03/2014, 15:20
... DNA lesions depends on the capacity of
the cell to repair the damage before it can be incorporated
permanently into the genome. Typically, DNA damage is
repaired at a relative high rate in human ... survival) after irradiation. The in vivo
biological activity was assayed by the ability to prevent UV
induced erythema of human skin. After informed consent
and approval from the Ethical Committee ... cyanobacteria,
corals and other marine organisms are much more
advanced than those of mammals because photosynthetic
organisms depend on solar irradiation as their primary
source of energy, and at the same time...
- 5
- 450
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
Ngày tải lên :
07/03/2014, 17:20
... collec-
tion and refinement are summarized in Table 1. The
program procheck [34] was used to analyse conforma-
tional variations from the defined norms, with the
quality of the Ramachandran plots [35] ... To accommodate
K100 as a ligand a number of main-chain atoms are
displaced relative to their positions in the wt structure.
Although backbone deviations are detected at the start
of the ligand ... the rearrangement of the ‘open’ and
‘closed’ forms of the ligand loop [19]. Therefore, con-
former A may be considered as the open form, albeit
with the axial ligand still intact, with the main-...
- 15
- 509
- 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
Ngày tải lên :
23/03/2014, 12:20
... in the databases. The two proteins migrating
at 50 and 55 kDa (bands A and B; Fig. 1A) were
identified from their N-terminal sequences as similar to
a- amylase (accession no. AAA17751) from ... and
analysed by SDS/PAGE.
Carboxypeptidase assays and expression
of HaCA42 mRNA
Carboxypeptidase assays using the synthetic substrates
furylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala-Lys
(FAAK) ... enzyme was
analysed by SDS/PAGE (data not shown). By analogy with
the activation of mammalian carboxypeptidases, these
polypeptides correspond to the active HaCa42 carboxy-
peptidase (36 kDa polypeptide)...
- 12
- 458
- 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
Ngày tải lên :
23/03/2014, 12:20
... of all the b Na-ScTxs from all
the a Na-ScTxs. The a Na-ScTxs have identities of the order
of 50% among themselves, the same being true for all the
b Na-ScTxs (data not shown). However, when the ... constraints were
added to the calculations. The dynamic annealing struc-
ture calculations were performed with the CNS software
suite [44].
Analysis of Na
+
-channel sequences
By searching data banks ... than the cardiac isoform rNa
V
1.5
[67]). However, when the overall charge of both the toxins
and the channels are considered together, a plausible
explanation comes from analysis of the other region
involved...
- 13
- 434
- 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
Ngày tải lên :
23/03/2014, 17:21
... GWMSKIASGIGTFLSGMQQa
DRS B1 AMWKDVLKKIGTVALHAGKAALGAVADTISQa
DRS B2 GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa
DRS B3 ALWKNMLKGIGKLAGQAALGAVKTLVGAE
DRS B4 ALWKDILKNVGKAAGKAVLNTVTDMVNQa
DRS B6 ALWKDILKNAGKAALNEINQLVNQa
PBN2 ... 5Â-AGCATAACTGGAACGTGGG-3Â for
caerin 1.12, 5Â-CAGCAATAAGTGGAACAACG-3Â for
caerin 1.13, 5Â-GTGTTTAGCAACGGATTTACC-3Â
for caerin 1.14 and 5Â-AGCAACGGATCCTAGGA
CAC-3Â for caerin 1.15. The temperature ... isolated
India between 150 and 65 Ma and colonized the Laurasian land mass
after India collided with Asia. Abbreviations; AF, Africa; IND, India;
AUS, Australia; SA, South America; ANT, Antartica....
- 14
- 305
- 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
Ngày tải lên :
23/03/2014, 21:20
... human
fibrosarcoma and MCF 7 from human breast adenocarci-
noma, were obtained from the Istituto Zooprofilattico
Sperimentale della Lombardia e dell’Emilia, Brescia, Italy.
Lipids. A series of natural and ... LUVs.
Similar aggregates appeared only very faintly in the absence
of lipids (Fig. 4A) . The rather long lag phase preceding fast
hemolysis (Fig. 1A) may also indicate that the formation of
a functional ... by the mushroom Agrocybe aegerita [3,4].
Moreover, 13 of the ESTs, if translated, are identical with a
138-amino-acid protein (PriA) translated from P. ostreatus
cDNA (EMBL/GenBank/DDBJ databases:...
- 12
- 492
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2