0

desai mihir a c fritz foley and james r hines jr 2004 the costs of shared

IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

Y khoa - Dược

... Akimaru et al 1996), and transcriptional activators such as MITF Some of the other coactivators with HAT activity include PCAF, Esa1, NuA4, and steroid receptor coactivators Transcription factors ... Transcription factors can also render their effect by activating or repressing the transcriptional pathway of another transcription factor Though several transcription factors control commitment of HSCs ... structures found in eukaryotes are euchromatin and heterochromatin Heterochromatin Heterochromatin is a tightly packed form of DNA and is characteristic of transcriptionally repressed genes and repetitive...
  • 144
  • 242
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Hepatic splenosis mimicking HCC in a patient with hepatitis C liver cirrhosis and mildly raised alpha feto protein; the important role of explorative laparoscopy" potx

Báo cáo khoa học

... Picciotto FP, Marsilia GM, Ascione A: Hepatic splenosis misinterpreted as hepatocellular carcinoma in cirrhotic patients referred for liver transplantation: report of two cases Liver Transpl 2004, ... Picciotto FP, Marsilia GM, Ascione A: Hepatic splenosis misinterpreted as hepatocellular carcinoma in cirrhotic patients referred for liver transplantation: report of two cases Liver Transpl 2004, 10:706-709 ... Di Costanzo GG, Picciotto FP, Marsilia GM, Ascione A: Hepatic splenosis misinterpreted as hepatocellular carcinoma in cirrhotic patients referred for liver transplantation: report of two cases...
  • 4
  • 451
  • 0
Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

Báo cáo khoa học

... Gb3 content of the liver was increased in Fabry mice and this was reduced in CsAtreated, compared with control mice after recovery from ERT CsA treatment reduced the liver Gb3 content overall ... B-cell lines from Gaucher and Fabry LSD patients were cultured with lm CsA for four days The GSL fractions were purified and separated by thin layer chromatography (TLC) Figure 1A shows the accumulation ... patient access and promoted the development of alternative strategies Gene therapy is a candidate strategy for Fabry which may eventually prove the most satisfactory [15] The third approach has...
  • 12
  • 432
  • 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Báo cáo khoa học

... BRL (Breda, The Netherlands) All other standard chemicals were either obtained from Sigma or Merck Potato arabinogalactan and onion arabinogalactan were obtained as described previously (Fractions ... detected against any of the transgalactooligosaccharides listed in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant ... (5¢-GATGATCTACCCTCTGCTTC-3¢ and 5¢-GTC ACGGACGGACTGGGT-3¢) Northern analysis was performed as described previously [20] Per sample, lg of total RNA was loaded on the gel The A niger galA accession...
  • 9
  • 669
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Hóa học - Dầu khí

... ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific PCR upper primer TGT GCT GCC ATA TCT ACT TCA GAA ... confirm the crystalline phase of superparamagnetic nanoparticles Table Hybridization probes and type-specific PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT ... GAA ACT AC Type-specific PCR lower primer TAG ACC AAA ATT CCA GTC CTC CAA A Yu-Hong et al Nanoscale Research Letters 2011, 6:461 http://www.nanoscalereslett.com/content/6/1/461 Page of Modification...
  • 9
  • 469
  • 0
Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Báo cáo khoa học

... normal rats and from rats with unilateral acute and chronic antigen-induced arthritis (AIA) in the knee, cultured them for one day and determined which proportion of DRG neurones express receptors ... by application of the COX inhibitor indomethacin to the co-culture Together, these data indicate a crucial role of prostaglandins in NK1 receptor upregulation at the acute stage of inflammation ... kits for PGE2 (Cayman Chemicals, Ann Arbor, Michigan, USA) and for rat IL-6 (OptEIA; BD Biosciences, Heidelberg, Germany) Data analysis From each cover slip, 100 structurally intact and NSE-labelled...
  • 12
  • 184
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " A phase III trial comparing an anionic phospholipid-based cream and aloe vera-based gel in the prevention of radiation dermatitis in pediatric patients" pdf

Báo cáo khoa học

... was as follows: grade – none or no change; grade – scattered macular or papular eruption or erythema that is asymptomatic; grade – scattered macular or papular eruption or erythema with pruritis ... desiccation and degradation focus on the lamellar structure of the stratum cornea and maintenance of the lipid bilayers, which requires a combination of external and internal oils and moisture ... conducted patient exams and participated in data collection TD participated in the collection of data and data analyses CL and XX assisted in writing the manuscript All authors read and approved the...
  • 8
  • 562
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The epidemiology of severe sepsis in England, Wales and Northern Ireland, 1996 to 2004: secondary analysis of a high quality clinical" pps

Báo cáo khoa học

... critical care for England, Wales and Northern Ireland and is co-ordinated by the Intensive Care National Audit & Research Centre (ICNARC) [13] Patient data are abstracted by trained data collectors ... general critical care units in England, Wales and Northern Ireland: the Intensive Care National Audit & Research Centre Case Mix Programme Database Crit Care 2004, 8 :R9 9-111 14 Knaus WA, Draper EA, ... categorical data (number of organ dysfunctions); and multinomial logistic regression for unordered categorical data (surgical status, pre-admission critical care, critical care transfers) Median regression...
  • 10
  • 340
  • 0
Effect of using HIV and infant feeding counselling cards on the quality of counselling provided to HIV positive mothers: a cluster randomized controlled trial

Effect of using HIV and infant feeding counselling cards on the quality of counselling provided to HIV positive mothers: a cluster randomized controlled trial

Sức khỏe giới tính

... Paediatrician, lecturer and researcher, currently the Director of the Paediatric Centre of Excellence for Paediatric HIV/AIDS and PI for the UTH HIV and AIDS programme (UTH-HAP) at the University ... of the manuscript All authors read and approved the final manuscript Authors’ information MKB is a Paediatrician, public health specialist and researcher currently works as the National Profession ... as the general awareness of Acquired Immune Deficiency Syndrome (AIDS) is universal (99%) among all subgroups of women and men regardless of their background characteristics [8] In the same report,...
  • 10
  • 855
  • 0
Báo cáo y học:

Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"

Y học thưởng thức

... macrovascular disease in diabetes Diabetes Care 1995; 18: 258-268 Haffner SJ, and Cassells H Hyperglycemia as a cardiovascular risk factor The American Journal of Medicine 2003; 115: 6S-11S Porte ... fluorescence signal was recorder for 40 sec The change in fluorescence was calculated as the ratio of F/ F0 equal to = [ (A4 60 /A5 80)/(I460/I580)], where A and I represent the readings after or before ... while a ratio greater than demonstrates transport across the plasma membrane mediated by SGLT To validate this assay, studies with D-glucose as a substrate of SGLT were performed and the correlation...
  • 9
  • 650
  • 0
A STUDY ON ENGLISH WORDS FORMED BY CONVERSION RELATING TO THE NAMES OF ANIMALS

A STUDY ON ENGLISH WORDS FORMED BY CONVERSION RELATING TO THE NAMES OF ANIMALS

Khoa học xã hội

... fact, this word formation process occurs so regularly that many scholars prefer to consider it a matter of syntactic usage rather than as word formation I.2 Characteristic features The new words ... characteristics, habits Each of animals has its typical character Basing on typical characters of animals, people convert many nouns naming animals into verbs and adjectives… It is called conversion ... functions of the words “doctor” are different The verb “doctor” was derived and has function as a predicate There is a change part of speech from a noun to a verb and function from a subject complement...
  • 71
  • 751
  • 1
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Báo cáo khoa học

... 3-Ketoacids readily undergo decarboxylation under mild conditions, and loss of CO2 can occur readily only from the free carboxylic acid [23] Decarboxylation has a concerted mechanism with an aromatic ... prepared crude extracts The absorption peaks at 263 and 294 nm characteristic of 4-amino-3-hydroxybenzoic acid decreased as the enzyme reaction proceeded and were almost completely absent after ... ethyl acetate The upper layer was collected and concentrated to 10 mL The extracted products were mixed with an equimolar concentration of pentafluorophenylhydrazine at 24 C for 30 The reaction...
  • 7
  • 613
  • 1
Tài liệu Báo cáo Y học: Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase doc

Tài liệu Báo cáo Y học: Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase doc

Báo cáo khoa học

... uncharged polar amino acids (i.e Q, N, S, and T) and an increase in charged amino-acid residues (i.e K, E, and R) in hyperthermophilic proteins As S and T can catalyze the deamination and backbone ... [39,40] The Ea values of BLXI inactivation were calculated for the apoenzyme in the presence and absence of metals (Table 3) The nature of the metal present clearly affected the Ea of BLXI inactivation ... Differential scanning calorimetry (DSC) DSC experiments were performed on a Nano-Cal differential scanning calorimeter (Calorimetry Sciences Corp., Provo, UT, USA) using a scan rate of 8C min21 Samples...
  • 11
  • 478
  • 0
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx

A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx

An ninh - Bảo mật

... ApplicationProgram and OperatingSystem Important facetings of ComputerProgram-CW are ComputerProgramTypeByPlatform and ComputerProgramTypeByFunction The latter faceting has 389 instances and includes collections ... hypothetical attacker exploits a merely locally exploitable vulnerability, the planner must incorporate prior steps that grant the attacker local access 3.2 Planner Cyc’s planner is a variant of ... CycSecure Architecture Overview The architecture of the CycSecure system is centered on a CycSecure server The server in turn rests on a Cyc image, which includes the components described above,...
  • 6
  • 490
  • 0
MEED S.A. The Costs of Water Pollution in India potx

MEED S.A. The Costs of Water Pollution in India potx

Điện - Điện tử

... India, 1997 and 2000 State/Union Territory Andhra Pradesh Assam Bihar Goa Gujarat Haryana Himachal Pradesh Jammu and Kashmir Karnataka Kerala Madhya Pradesh Maharashtra Orissa Punjab Rajasthan Tamil ... standards Mar-95 Andhra Pradesh Assam Bihar Goa Gujarat Haryana Himachal Pradesh Jammu and Kashmir 173 15 62 177 43 Dec-2000 32 11 1 0 0 17 Karnataka Kerala Madhya Pradesh Maharashtra Orissa Punjab ... Imperatives" Water and Sanitation Program Bhatnagar P .R Sharma B .R (2002) "Groundwater Pollution through Agricultural Practices and Agro Industries in India" IWMI-TATA Water Policy Program Brandon...
  • 55
  • 933
  • 0
The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

Quản lý dự án

... each area, the interaction of the areas with the key project management processes described earlier, available management tools and techniques for each area, and input and outputs of each area ... Inc., 2004 Copyright and all rights reserved Project management area Projects are typically part of an organization The relationship between the project and organization varies, and that relationship ... becoming a key strategy for managing organizational change in contemporary organizations, with corporations, government, academia and other organizations recognizing the value of common project...
  • 12
  • 980
  • 0
Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc

Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc

Báo cáo khoa học

... and remained constant for at least h Hence, the reaction was left to proceed for 10 min, and the uorescence was then measured at room temperature Inuence of interference The inuence of the main ... of the plasma was derived from the standard curve and the regression equation The average recovery test was made using the standard addition method, and the RSD was generally good when obtained ... molặL)1) of GSH was prepared with ultra-pure water b-CD (China Medicine Group Shanghai Chemical Reagent Corporation, Shanghai, China) was puried by recrystallizing twice in ultra-pure water, followed...
  • 8
  • 429
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008