... the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, ... Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) from COS-7 cells harboring the wild-type SV40T Ag gene (purchased from Health Science Research Resources Bank, Osaka, Japan) ... homozygous mice are viable and fertile Experimental procedures p-MAPK Mice C5 7BL ⁄ 6J mice and MCH:ICR mice were purchased from CLEA Japan (Tokyo, Japan) Tie2–Cre transgenic mice (B6.Cg-Tg(Tek-cre)12Flv...
... of France, it was well hidden As for the chauffeur who had inspected my car, and afterwards met Carmona at another garage, he had disappeared, apparently, into thin air Nevertheless, Dick and ... his word Ropes, my chauffeur, and right-hand man, who sits always in the tonneau, had already heard all about the King's automobile, and was primed with particulars He leaned across to describe ... guessed his partner to be Lady Vale-Avon; and if I were right, it was a bad omen She was not a woman to care for extraneous dancing, therefore she favoured Carmona in particular Still, for the moment...
... 4, and 5) and transfected cells (lanes and 6) at 48 and 72 h after transfection results showed a greater decrease in luciferase activity as compared with controls, both in miR-23b-transfected and ... internal control RT-PCR analysis (Agilent) and real-time PCR Total RNA of transfected and nontransfected cells was extracted with Trizol reagent according to the manufacturer’s FEBS Journal 276 ... (lanes and 6) were examined by RT-PCR to detect uPA mRNA (A) and c- met mRNA (B), and by real-time PCR to detect miR-23b expression (C) RQ MicroRNAs have emerged as important negative regulators...
... data also indicate that CTD is comparatively more compact than NTD at room temperature CD spectra of CI, His-CI and CTD CD spectra measurement of proteins can predict about their secondary structural ... compared to those at 30 C Figure CD-spectra of His-CI and CTD CD-spectra of His-CI and CTD Far UV CD-spectra of His-CI and CTD (64–183 amino acid residues) were measured at 30° and 42 C separately ... cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This cloning has added extra 36 amino acid residues (including...
... data also indicate that CTD is comparatively more compact than NTD at room temperature CD spectra of CI, His-CI and CTD CD spectra measurement of proteins can predict about their secondary structural ... compared to those at 30 C Figure CD-spectra of His-CI and CTD CD-spectra of His-CI and CTD Far UV CD-spectra of His-CI and CTD (64–183 amino acid residues) were measured at 30° and 42 C separately ... cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This cloning has added extra 36 amino acid residues (including...
... Picciotto FP, Marsilia GM, Ascione A: Hepatic splenosis misinterpreted as hepatocellular carcinoma in cirrhotic patients referred for liver transplantation: report of two cases Liver Transpl 2004, ... Picciotto FP, Marsilia GM, Ascione A: Hepatic splenosis misinterpreted as hepatocellular carcinoma in cirrhotic patients referred for liver transplantation: report of two cases Liver Transpl 2004, 10:706-709 ... Di Costanzo GG, Picciotto FP, Marsilia GM, Ascione A: Hepatic splenosis misinterpreted as hepatocellular carcinoma in cirrhotic patients referred for liver transplantation: report of two cases...
... Example: BackColor ackC Camel Casing - First character of all words, except the first word are Upper Case and other characters are lower case Example: backColor ackC Use Pascal casing for Class ... Conventions and Standards Note : The terms Pascal Casing and Camel Casing are used throughout this document Pascal Casing - First character of all words are Upper Case and other characters are lower case ... to recover from error Do not write very large try-catch blocks If required, write separate try-catch for each task you perform and enclose only the specific piece of code inside the try-catch...
... his neck and hangs them on the ring post Paprachiat Fighters also commonly wear a cord around their bicep called the Kruang Ruang (armband) or Paprachiat (Good Luck Charm) These are usually given ... tree sa wadee Chan shue Khob chai mark Khob ton rub tharn Tharn sa bi dee rhuee Chan pood dai tae pasa Anglish Chan ma chark saha rat Prode pood hai sah kwa nee Chan mai khao chai Shuay chan noi ... Faad Lop Pang nga Saai Kwaa Kai Kai Muay Sanam Muay Muay acheep Gawn welaa Muay sakon Koo ek Sangwien Run Andap Kradot Gamagan Yaek Gaan Dadsin Dadsin Champ Nak Muay 38 Fight Box up Red corner...
... collected and averaged for each experiment ATR-IR spectroscopy Aliquots of samples were taken from each of the samples used for CD spectroscopy and dried over the ATR diamond surface of a Bruker ... were carried out at a temperature of 25 C on a Bruker Avance spectrometer equipped with a broad band inverse probe operating at a 1H Larmor frequency of 400 MHz Increasing amounts of SDS were ... for the formation of aggregated species, whereas higher concentrations [well above the critical micelle concentration (CMC)] instead promote the formation of a- helical structures, protected from...
... 809 The Role of the IDbCommand Interface 809 The Role of the IDbDataParameter and IDataParameter Interfaces 810 The Role of the IDbDataAdapter and IDataAdapter Interfaces ... Directly Creating StreamWriter/StreamReader Types 774 Working with StringWriters and StringReaders 774 Working with BinaryWriters and BinaryReaders 776 Watching Files Programmatically ... or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed...
... technologies Are racially and ethnically diverse; one in five has at least one immigrant parent Are focused on grades and performance Are busy with extracurricular activities When asked about ... and the other was Union Census data, agricultural records, newspaper articles, church records, and letters from soldiers and their families constitute the original source material that allows students ... the many skills that new technology [has] actually enhanced (for example, parallel processing, graphics awareness, and random access)—which have profound implications for their learning—are almost...
... earlier data5 for tra c of Telstra, the dominant Australian carrier, this suggests that Australia experienced several years of regular doubling every year, then a remarkable slowdown in the growth ... hands-off attitudes towards Internet tra c, that appears to be changing In particular, Australia’s government has recently started collecting and publishing statistics The Australian semi-annual ... distance carriers created in the late 1990s have built large backbones, but have hardly any tra c This is a temporary situation that will disappear with time, but there are other factors that are likely...
... vesicles were obtained on a Jasco J-715 spectropolarimeter Four scans were accumulated and averaged for each spectrum The acquired spectra were corrected by subtracting the appropriate blank runs ... were HPLCgrade (Scharlau, Barcelona, Spain) All other reagents were of analytical grade and were obtained from Merck (Darmstadt, Germany) Expression and isolation of CTC CTC was expressed and ... Effects of urea on CTC secondary structure CD spectra of CTC in 0–8 M urea increasing by M steps, as indicated by the arrows (A) Nonreduced CTC (B) Reduced CTC (C) Residual molar ellipticity at...
... three proteins are steroid receptor co-activator (SRC-1), glucocorticoid receptor-interacting protein (GRIP1, also called TIF2), and activator for thyroid hormone and retinoid receptors (ACTR) ... (also called RAC3, pCIP, AIB1 and TRAM1) These co-activators bind directly to the DNA-bound NRs and apparently function by recruiting secondary co-activators, such as CBP ⁄ p300, co-activator-associated ... highly conserved N-terminal bHLH-PAS domain of p160 co-activators by recruitment of secondary co-activators, including coiled-coil co-activator (CoCoA) and GRIP1-associated co-activator 63 (GAC63)...
... Trade Organizations ASEAN Association of Southeast Asian Nations IMF International Monetary Fund APEC Asia - Pacific Economic Cooperation ASEM Asia - Europe Meeting VCCI Chamber of Commerce and ... only responsible for society, consumers, workers and environment if its manager has awareness and commitment to CSR According to Harris and Crane, they argued, “If managers are at least partly ... According to Schultz et al (2005), the direct ways are external and formal channels such as reports, brochures and websites The indirect ways are less formal channels such as articles in local...
... following chapters: Chapter1: Introduction Chapter 2: Literature Review Chapter 3: Research Methodology Chapter 4: Result Analysis Chapter 5: Conclusion and Recommendation 16 CHAPTER 2: LITERATURE REVIEW ... social value and environmental that they add The term of TBL 22 is used as a framework for measuring and reporting corporate performance against economic, social, and environmental parameters ... 1979-1991 conceptualizations According to Archie Carroll (1947), there are four categories of social responsibility: Economic, Legal, Ethical, and Discretionary And 1999, he introduced the Pyramid that...
... provides a reusable interface and an adequate random number generator We use the implementation to introduce and illustrate the adapter pattern, and to examine further the decorator pattern We move ... instead.” “Hmm, I miss the standard error can we see that too.” “We need a digital call pricer now!” “What about geometric average Asian calls?” “How about arithmetic average Asian puts?” “Take care ... generator is a random number generator Box–Muller is a method of turning uniform random variables into Gaussian random variables An Asian option is a path-dependent exotic option An arithmetic Asian...